ID: 1166246495

View in Genome Browser
Species Human (GRCh38)
Location 19:41530854-41530876
Sequence TTTCGCATACCGGAACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166246492_1166246495 -1 Left 1166246492 19:41530832-41530854 CCGCCAGCTGATGTTCTGCTTAT No data
Right 1166246495 19:41530854-41530876 TTTCGCATACCGGAACTCCCAGG No data
1166246490_1166246495 7 Left 1166246490 19:41530824-41530846 CCCTTCAGCCGCCAGCTGATGTT No data
Right 1166246495 19:41530854-41530876 TTTCGCATACCGGAACTCCCAGG No data
1166246491_1166246495 6 Left 1166246491 19:41530825-41530847 CCTTCAGCCGCCAGCTGATGTTC No data
Right 1166246495 19:41530854-41530876 TTTCGCATACCGGAACTCCCAGG No data
1166246493_1166246495 -4 Left 1166246493 19:41530835-41530857 CCAGCTGATGTTCTGCTTATTTC No data
Right 1166246495 19:41530854-41530876 TTTCGCATACCGGAACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166246495 Original CRISPR TTTCGCATACCGGAACTCCC AGG Intergenic
No off target data available for this crispr