ID: 1166246500

View in Genome Browser
Species Human (GRCh38)
Location 19:41530883-41530905
Sequence CAAACCACAATCACAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166246496_1166246500 -3 Left 1166246496 19:41530863-41530885 CCGGAACTCCCAGGCGTCCTCAA No data
Right 1166246500 19:41530883-41530905 CAAACCACAATCACAGTTGTTGG No data
1166246492_1166246500 28 Left 1166246492 19:41530832-41530854 CCGCCAGCTGATGTTCTGCTTAT No data
Right 1166246500 19:41530883-41530905 CAAACCACAATCACAGTTGTTGG No data
1166246493_1166246500 25 Left 1166246493 19:41530835-41530857 CCAGCTGATGTTCTGCTTATTTC No data
Right 1166246500 19:41530883-41530905 CAAACCACAATCACAGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166246500 Original CRISPR CAAACCACAATCACAGTTGT TGG Intergenic
No off target data available for this crispr