ID: 1166246812

View in Genome Browser
Species Human (GRCh38)
Location 19:41534199-41534221
Sequence TCCCTACATTGAAGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166246810_1166246812 8 Left 1166246810 19:41534168-41534190 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166246812 Original CRISPR TCCCTACATTGAAGGAGTGC TGG Intergenic
No off target data available for this crispr