ID: 1166248057

View in Genome Browser
Species Human (GRCh38)
Location 19:41545111-41545133
Sequence ACCGAGACATTCAGTTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166248057_1166248061 16 Left 1166248057 19:41545111-41545133 CCCTCAGAACTGAATGTCTCGGT No data
Right 1166248061 19:41545150-41545172 CATTTGTTCAACTCTGAGATAGG 0: 15
1: 156
2: 91
3: 85
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166248057 Original CRISPR ACCGAGACATTCAGTTCTGA GGG (reversed) Intergenic
No off target data available for this crispr