ID: 1166251342

View in Genome Browser
Species Human (GRCh38)
Location 19:41573020-41573042
Sequence AAGCTTGGTCTACCTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166251342_1166251351 22 Left 1166251342 19:41573020-41573042 CCTGTGCCAGGTAGACCAAGCTT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1166251351 19:41573065-41573087 AAGGAGATGGAGGTCTGACCAGG 0: 1
1: 0
2: 0
3: 17
4: 257
1166251342_1166251350 12 Left 1166251342 19:41573020-41573042 CCTGTGCCAGGTAGACCAAGCTT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1166251350 19:41573055-41573077 AATGAGAGAGAAGGAGATGGAGG 0: 1
1: 1
2: 19
3: 216
4: 2080
1166251342_1166251349 9 Left 1166251342 19:41573020-41573042 CCTGTGCCAGGTAGACCAAGCTT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1166251349 19:41573052-41573074 GGCAATGAGAGAGAAGGAGATGG 0: 1
1: 1
2: 14
3: 172
4: 1694
1166251342_1166251347 3 Left 1166251342 19:41573020-41573042 CCTGTGCCAGGTAGACCAAGCTT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1166251347 19:41573046-41573068 GCCTCAGGCAATGAGAGAGAAGG 0: 1
1: 0
2: 2
3: 28
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166251342 Original CRISPR AAGCTTGGTCTACCTGGCAC AGG (reversed) Intronic
903044049 1:20552805-20552827 AAGCTAGCCCTGCCTGGCACTGG + Exonic
903827000 1:26153598-26153620 AGGCTTGATCTACCGGGCTCAGG + Intergenic
904608009 1:31709230-31709252 AAGATGGGTCTCCCTGCCACAGG - Intergenic
906291212 1:44620394-44620416 ATGCTTGCTCTACCTGGCCTAGG - Intronic
908779031 1:67671662-67671684 AGGATAGGTCTAACTGGCACAGG + Intergenic
920377154 1:205515110-205515132 AAGCCTGGTCTGCCAGGCCCTGG + Intronic
921284266 1:213594938-213594960 AATCTTGGCCTTCGTGGCACTGG + Intergenic
922005178 1:221523043-221523065 CAGGTTGGGCTACCTGGCTCTGG - Intergenic
1064035167 10:11908652-11908674 AAGCCAGGTCCACCTGGCAGGGG + Intergenic
1065628185 10:27652725-27652747 CTGCTTGATCTACCTGGCTCTGG - Intergenic
1071059842 10:81556565-81556587 AAGCTTGGATTAACTGGCATAGG + Intergenic
1073289079 10:102404570-102404592 GAGCTTGGGCTACCTGGGAGAGG + Exonic
1074245204 10:111683294-111683316 AAGCTTGATCTAATGGGCACAGG - Intergenic
1074853580 10:117457445-117457467 AAGCTTGCCCTACCGGGTACAGG + Intergenic
1076096885 10:127739396-127739418 CAGCTTGGCCCACCTGGCTCAGG + Exonic
1084004954 11:66317721-66317743 CAGCTTGGTCACCCAGGCACAGG + Intergenic
1086661230 11:89420995-89421017 AAGCATGGTCTACCTTGCATTGG - Intronic
1088313565 11:108485159-108485181 AAGCTTGGGCTACCAGAAACAGG - Intronic
1101609143 12:106274537-106274559 AAGACTGGCCAACCTGGCACTGG + Intronic
1106335360 13:28778404-28778426 CAGCATGGTCTCCCTGGCCCAGG + Intergenic
1106391549 13:29339472-29339494 CAGCATGGTCTCCCTGGCACAGG + Intronic
1107003340 13:35577306-35577328 ACTCTTGGTCTACCTGGTGCAGG - Intronic
1109760701 13:66824925-66824947 CAGCTTGAGATACCTGGCACTGG - Intronic
1114533743 14:23410525-23410547 AAGGCTGGCCTCCCTGGCACAGG + Intergenic
1119770837 14:77219813-77219835 ATGCCTGGTGTACCTGGCACAGG + Intronic
1123186868 14:106527523-106527545 AACCCTGGTCAATCTGGCACAGG + Intergenic
1123804065 15:23853281-23853303 AAACTTGGTCTCCCCTGCACTGG - Intergenic
1124669496 15:31625251-31625273 AAGCGTGGTGTAACTGGCTCAGG - Intronic
1125182834 15:36897033-36897055 AAGCTGGGTCTCCCTATCACGGG - Intronic
1125851898 15:42912089-42912111 AAGCTTGGTCTACGTGAAAAGGG + Intronic
1129274934 15:74438855-74438877 AAACTTGGCCAACGTGGCACTGG + Intergenic
1133775066 16:8889398-8889420 GAGCTAGGGCTACCTGGAACAGG + Intergenic
1134791499 16:16993194-16993216 AAGCTTGGTCTGCCTGTCTTGGG + Intergenic
1143599975 17:7938708-7938730 AACCCAGGTCTACCTGGCTCTGG + Intronic
1144168899 17:12639378-12639400 AACCTTGGTCTACCTGAGCCTGG - Intergenic
1150970770 17:70024974-70024996 ACGCTTTGTCTACCTGGAGCTGG + Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1151928402 17:77215231-77215253 AAGCCTGCTCTATCTGGTACAGG + Intronic
1159861489 18:73654495-73654517 AATCTTGGACTGCCTGACACGGG + Intergenic
1160629910 18:80239565-80239587 AAGCTTGGTCTACAAGGAAGGGG + Intronic
1165755621 19:38291133-38291155 AAGCCTGGTTTGCCAGGCACGGG + Intronic
1166251342 19:41573020-41573042 AAGCTTGGTCTACCTGGCACAGG - Intronic
1167374991 19:49106110-49106132 GAGCGTGGTCTCCCTAGCACAGG - Intronic
928208543 2:29305602-29305624 AAGCTGGGTATACTTGGCATGGG - Intronic
929618031 2:43327620-43327642 AAGCTGGGTTTAGGTGGCACAGG + Intronic
932161796 2:69466852-69466874 ACACCTGCTCTACCTGGCACTGG + Intronic
934638354 2:96010723-96010745 AGGCCTGGTCTACCTGGCGGCGG - Intergenic
934795301 2:97094688-97094710 AGGCCTGGTCTACCTGGCGGCGG + Exonic
935784370 2:106535321-106535343 AACCTTGGTCTATGTGGCATTGG - Intergenic
942604628 2:177677494-177677516 AACCTTTGTCCATCTGGCACTGG + Intronic
948513457 2:238488327-238488349 ACCCTTGGCCTACATGGCACAGG + Intergenic
1168764095 20:370176-370198 AATCTTGGCCTACCTGGCTCAGG + Intronic
1176223474 20:63980936-63980958 AAGCTAGGTCGAGCTTGCACTGG - Intronic
1176289647 21:5037306-5037328 AAGCATGTGCTACCTGGCTCGGG - Intronic
1178907412 21:36648100-36648122 CACCTTGGTCTACCTTGCCCAGG - Intergenic
1179867583 21:44226281-44226303 AAGCATGTGCTACCTGGCTCGGG + Intronic
1180965495 22:19786111-19786133 AAGCTGGATCTGCCTGGCAAGGG + Exonic
1183004890 22:34892947-34892969 AAGATTGCTCTACCTGCCATGGG + Intergenic
954355164 3:50078952-50078974 AAGCTTAGTCTACTTGTCACTGG + Intronic
956777021 3:72573575-72573597 AAGCTTGGTCTACCTGTAGGAGG + Intergenic
956956137 3:74343203-74343225 AGGCTTAGCCTTCCTGGCACAGG + Intronic
961533659 3:127556012-127556034 AAGGTTGGGATGCCTGGCACAGG - Intergenic
962265876 3:133943983-133944005 AAGCCTGGCCTGCCTGGCTCTGG + Intronic
963727005 3:148934153-148934175 AATCTTGTTCTACCTGCTACTGG + Intergenic
967549183 3:190769871-190769893 AAGCTTGATCTAACAGGTACTGG + Intergenic
971137719 4:23888150-23888172 AAGCTTTGCCTACATGGCAGCGG - Intronic
976381643 4:84406223-84406245 AAACCTGGGCAACCTGGCACTGG - Intergenic
978423624 4:108560080-108560102 AAGCTGGTTCCATCTGGCACAGG - Intergenic
978785608 4:112606242-112606264 AAGCTAGCTCTCCCTGGCAAAGG + Intronic
983777039 4:171621214-171621236 AAGCTTATTCTCCCTGGCAAAGG - Intergenic
987358966 5:17089580-17089602 AAGCTTGGTTTCATTGGCACTGG - Intronic
987868624 5:23580581-23580603 AAGCTTCTTCCAGCTGGCACTGG - Intergenic
988397901 5:30719361-30719383 AAGCCTGGGCACCCTGGCACAGG - Intergenic
992569308 5:78038534-78038556 AAGCTTGACCAACCTGGCTCAGG - Intronic
1001278652 5:170369823-170369845 GAGGTTGGCCTACCTCGCACTGG + Intronic
1001955705 5:175846915-175846937 CAGCTTGGTCTAACTGCCCCTGG - Intronic
1006106751 6:31721478-31721500 AAGCCTGGTCTTGGTGGCACAGG + Intronic
1007834915 6:44666922-44666944 GAGCCTGGTCTTCCTGGCACAGG + Intergenic
1012406459 6:98906151-98906173 AAGCTGAGTGTTCCTGGCACAGG - Intronic
1014873549 6:126627416-126627438 AAGCTTTCTTTACCTAGCACAGG + Intergenic
1015595235 6:134860139-134860161 AAGTTTGGTTTACCTGAGACTGG + Intergenic
1015723428 6:136271341-136271363 TAGATTAGTCTACCTGGCAAAGG + Intronic
1020049708 7:5073248-5073270 CAGCCTGGCCTACCAGGCACGGG - Intergenic
1023494234 7:40777647-40777669 AAGCTGGGTCTGCTTGGGACTGG + Intronic
1034284981 7:149878640-149878662 AAGCATGGTGAGCCTGGCACAGG - Intronic
1035323752 7:158051471-158051493 AACCTTGGTGCACCTGACACAGG - Intronic
1037883718 8:22585542-22585564 AAGCATGGCCTCCCTGGCTCAGG - Intronic
1045820918 8:106336776-106336798 AAGTTTTGTCAACCTGCCACAGG - Intronic
1046941852 8:119939275-119939297 AAGCTTGGTCTGCCGGGGAAGGG + Intronic
1048241067 8:132741943-132741965 AACCTCGGTCCACCTGGCAACGG + Intronic
1053484369 9:38441043-38441065 AGCCTTGGTCTCCCTGGCCCAGG + Intergenic
1055054732 9:72013354-72013376 TAGCCTGGTCTTCCTGGCAGTGG + Intergenic
1056954880 9:91073872-91073894 AAGCTTGATCCACTTGGCACAGG + Intergenic
1186234062 X:7488198-7488220 AAGCTGGGGCTACCAGGCAGGGG + Intergenic
1186770595 X:12814309-12814331 AAGCTTGATTTTCCTGGCAGAGG - Intronic
1189242576 X:39537187-39537209 AACCTGGGTCTGCCTGGCTCCGG + Intergenic
1191897059 X:66003761-66003783 AAGTGTGCTCTACCAGGCACTGG - Intergenic
1195260078 X:103123179-103123201 AAGCTGGTCATACCTGGCACTGG + Intergenic
1195666254 X:107433777-107433799 CAGCTTTGTCTACCAGGTACTGG + Intergenic
1196158234 X:112454325-112454347 AAGCTTGGTCAACCTGTGGCTGG - Intergenic
1200900517 Y:8426669-8426691 AAGTTTGGTGTGCCTGGCACAGG + Intergenic