ID: 1166254823

View in Genome Browser
Species Human (GRCh38)
Location 19:41596035-41596057
Sequence ACCCTCTGATCACTTTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 173}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166254817_1166254823 4 Left 1166254817 19:41596008-41596030 CCCACATGGGGTCACCTGAAGCC No data
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254816_1166254823 10 Left 1166254816 19:41596002-41596024 CCATTTCCCACATGGGGTCACCT 0: 1
1: 0
2: 4
3: 21
4: 257
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254807_1166254823 26 Left 1166254807 19:41595986-41596008 CCCCACCTTCCCTTGGCCATTTC 0: 1
1: 0
2: 3
3: 28
4: 349
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254818_1166254823 3 Left 1166254818 19:41596009-41596031 CCACATGGGGTCACCTGAAGCCC 0: 1
1: 0
2: 3
3: 18
4: 172
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254810_1166254823 21 Left 1166254810 19:41595991-41596013 CCTTCCCTTGGCCATTTCCCACA 0: 1
1: 0
2: 2
3: 25
4: 321
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254809_1166254823 24 Left 1166254809 19:41595988-41596010 CCACCTTCCCTTGGCCATTTCCC 0: 1
1: 0
2: 6
3: 54
4: 532
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254806_1166254823 29 Left 1166254806 19:41595983-41596005 CCACCCCACCTTCCCTTGGCCAT 0: 1
1: 0
2: 5
3: 48
4: 597
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254812_1166254823 17 Left 1166254812 19:41595995-41596017 CCCTTGGCCATTTCCCACATGGG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254819_1166254823 -10 Left 1166254819 19:41596022-41596044 CCTGAAGCCCCACACCCTCTGAT 0: 2
1: 1
2: 1
3: 20
4: 285
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254808_1166254823 25 Left 1166254808 19:41595987-41596009 CCCACCTTCCCTTGGCCATTTCC 0: 1
1: 0
2: 5
3: 30
4: 347
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254814_1166254823 16 Left 1166254814 19:41595996-41596018 CCTTGGCCATTTCCCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 205
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173
1166254805_1166254823 30 Left 1166254805 19:41595982-41596004 CCCACCCCACCTTCCCTTGGCCA 0: 1
1: 0
2: 3
3: 62
4: 543
Right 1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG 0: 1
1: 1
2: 3
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166254823 Original CRISPR ACCCTCTGATCACTTTCCCA TGG Intronic
902042381 1:13502327-13502349 TCCTTCTGGTCACTTTTCCAGGG + Intronic
905477869 1:38241656-38241678 CCCCTCTGCTCACTCTCCCAGGG + Intergenic
906154197 1:43604595-43604617 ACCCTCTGATCACTCTGGCCTGG + Intronic
907719460 1:56958156-56958178 ATCCTGTAATCACTTTCCTAAGG - Intronic
909394107 1:75150455-75150477 ACCCTATGATCTCTTTCTAAAGG - Intronic
912638674 1:111322652-111322674 TCCCTATTATCACTTTCCAATGG - Intergenic
913433857 1:118826724-118826746 ACCCTCTCCTCACTTCCCCAAGG + Intergenic
915038601 1:152948883-152948905 CGCCTCTGATCACATGCCCAGGG - Intergenic
919929011 1:202209071-202209093 TCCCAGTGATCACATTCCCAGGG - Intronic
920011715 1:202872913-202872935 ACCCTCTGAAGACTTAGCCATGG + Intergenic
920555167 1:206899240-206899262 ACCCTCGGAGCATTTTCCCAGGG + Intronic
920752490 1:208692936-208692958 ACCCTCAGATCACTGTACCTTGG - Intergenic
921644339 1:217596365-217596387 ACCCTGTGGCCAATTTCCCAAGG - Intronic
922050747 1:221988433-221988455 ACCCTCTGTTTACTTTGCCTTGG + Intergenic
922217054 1:223528427-223528449 ACCCTCCTGTCACTTTCCCTTGG + Intergenic
1063037132 10:2297486-2297508 ACAATCTGACCACTTCCCCAAGG + Intergenic
1063386999 10:5622081-5622103 ACCCTCCTGTCACTTTCCCTTGG - Intergenic
1065322734 10:24524272-24524294 ACCCTCATGTCACTTTCTCATGG - Intronic
1066449165 10:35512371-35512393 TTCCTCTAAACACTTTCCCAGGG - Intronic
1066705109 10:38169028-38169050 AGCCTCTGATCAGTATCCAAAGG + Intergenic
1067302334 10:45023343-45023365 TTCCTTTTATCACTTTCCCAGGG - Intergenic
1068599694 10:58943313-58943335 CCCCTCTGAGTATTTTCCCAAGG - Intergenic
1070819071 10:79344249-79344271 ACCCTCTCTTCACTCTCCCCAGG - Intergenic
1071689026 10:87795931-87795953 AACCTCTGATCTTTTTACCAAGG + Intronic
1073173825 10:101537744-101537766 ACACTCTGAACAATTTCCCAAGG - Intronic
1073709315 10:106020036-106020058 AGCCTCTGTTCACTTTCACCTGG - Intergenic
1075966244 10:126614212-126614234 TCCCCCTGCCCACTTTCCCAAGG + Intronic
1076516056 10:131045029-131045051 ATCCTCTGAGCTCTTTCCCACGG - Intergenic
1078327481 11:10392505-10392527 ACCCTCTTATCTGTTTCCCTGGG + Intronic
1079667432 11:23123893-23123915 ACTCTCTGATCACTGTGCAAAGG - Intergenic
1080424479 11:32143626-32143648 ACCCTCCTGTCACTTTCCCTCGG + Intergenic
1080550839 11:33372994-33373016 ACCCCTTGCTCACATTCCCATGG + Intergenic
1082986920 11:59177076-59177098 ACCATTTTACCACTTTCCCATGG + Intronic
1084085098 11:66851370-66851392 ACCCTCAGATCTCATTCCCCAGG - Intronic
1084698652 11:70771480-70771502 ACCTTCTGAGCACATTCTCAGGG + Intronic
1086303953 11:85459902-85459924 ACACTCTGGCCACTTTTCCATGG + Intronic
1089385602 11:118065536-118065558 AGCCTCTGGTCACTTTCCACAGG + Intergenic
1090677948 11:129021531-129021553 ACCGTATGACCATTTTCCCAAGG - Intronic
1091308939 11:134559399-134559421 ACCCTCTGACAACTCTCCCCGGG - Intergenic
1092852528 12:12643362-12643384 ACTCTCTCTTCTCTTTCCCATGG + Exonic
1095572292 12:43697076-43697098 TCCCTCTGAAGACTTTCCCATGG + Intergenic
1101231593 12:102747022-102747044 ACCCTCGAATCACATTCCAAGGG - Intergenic
1101820304 12:108179101-108179123 CTCCTCTAATCACTTTCACATGG + Intronic
1105745526 13:23374164-23374186 TCCTTCTGATCAGTTCCCCAAGG - Intronic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1106471653 13:30061331-30061353 ACCCTCCCATCACTTTCCCTAGG - Intergenic
1107658558 13:42616092-42616114 ACACACTTATCTCTTTCCCATGG - Intergenic
1108158294 13:47611173-47611195 GCCCTCTGCTCATTTTCTCAGGG - Intergenic
1114985439 14:28221519-28221541 TCCCTCTGATCATTTTCACTGGG - Intergenic
1115973473 14:38971622-38971644 ACCCTCTCAGCACTTTTGCAAGG + Intergenic
1116338915 14:43696949-43696971 ACGATCTAATCACTTTCCAAAGG - Intergenic
1116607714 14:47023268-47023290 AACCTTTGATCTCTTTCCCTTGG - Intronic
1117432763 14:55685869-55685891 GCCTTCAGATCAATTTCCCAAGG - Intronic
1120796319 14:88636743-88636765 AACATCTAATCACATTCCCATGG - Intronic
1121727948 14:96166600-96166622 ACCCTCTGGCCACTTTCCACTGG - Intergenic
1121760438 14:96440424-96440446 ACCCTCTGCTCTCTCTCCCTTGG + Intronic
1123011833 14:105353124-105353146 ACCCCCTCATCACTGTCCCCTGG + Intronic
1123011871 14:105353220-105353242 ACCCCCTCATCACTGTCCCCTGG + Intronic
1124638807 15:31382289-31382311 ACCCTCTGAGCACTCTCAGAGGG + Intronic
1126507836 15:49428467-49428489 ACCCTCTGATCTTGTCCCCATGG - Intronic
1126835527 15:52660456-52660478 ATCCTCTGCTCATTTTCTCAGGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128743433 15:70098085-70098107 ACCCGCTGGTGACTTTCGCATGG + Exonic
1131620946 15:94067552-94067574 ACCCTCTGACCACATTCCTATGG - Intergenic
1132292087 15:100710894-100710916 TCCTTCTGCTCACTTTTCCAGGG - Intergenic
1133917908 16:10125740-10125762 ACCCTCCATCCACTTTCCCAGGG - Intronic
1134227441 16:12402158-12402180 CCCCATTGATCACTTCCCCAGGG - Intronic
1135150669 16:20002522-20002544 GCCCTTTGATCCCTCTCCCAAGG - Intergenic
1139527449 16:67525634-67525656 ACCCTCTGCTGTCTGTCCCAGGG + Intronic
1139598112 16:67969618-67969640 ACCCTCTGACCCCTCCCCCAGGG + Intergenic
1148189224 17:45667110-45667132 AACCTCTGATTCCTTTCTCAGGG + Intergenic
1149554825 17:57565902-57565924 AACATCTGTTTACTTTCCCAGGG + Intronic
1150017748 17:61575475-61575497 GCCCTCTGACCACTTTGCCTTGG + Intergenic
1150131648 17:62672369-62672391 ACCCTCTAGTAACTTGCCCAAGG - Intronic
1152971465 18:165732-165754 CCCCTAAGATCACTTACCCAAGG - Intronic
1156702715 18:39843592-39843614 ACCCTCTTCTCACGTTCCCTAGG + Intergenic
1156857197 18:41795558-41795580 ACCCTCTGACTACTTTCACTTGG - Intergenic
1156965928 18:43092132-43092154 ATCCTCTGATAATTTTTCCAAGG - Intronic
1158841742 18:61395124-61395146 ACCCTCTGCTCTCTGTCCCCTGG + Intronic
1161508589 19:4657819-4657841 ACCCTCTGTTCTCTGCCCCAGGG + Exonic
1163103013 19:15108977-15108999 ACCCACTGATCAATTGCACAGGG + Intronic
1163778441 19:19232043-19232065 CCCCTCTGATCATCTTTCCAGGG - Intronic
1165060249 19:33201611-33201633 ACTCTCTCCTCACTCTCCCATGG - Intronic
1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG + Intronic
1166275007 19:41747382-41747404 ACCCTCTGATCACGTTCCAATGG + Intronic
1166280097 19:41786666-41786688 ACCTTCCGGTCCCTTTCCCACGG + Intergenic
1166396659 19:42446177-42446199 ACCCACTGCTCACTTTCCCACGG - Intergenic
1166412655 19:42566563-42566585 ACCCTCTGGTCACTTTCCCATGG - Intergenic
1167473132 19:49686391-49686413 ACACTCAGGTCACTTGCCCAAGG - Intronic
1167493167 19:49803229-49803251 TCCCTCTGACCCCTTCCCCAAGG - Intronic
926871796 2:17428093-17428115 TACTTCTGATTACTTTCCCAGGG + Intergenic
927683032 2:25152574-25152596 TCTCTCTGATCTCTTTGCCAAGG - Intronic
927687827 2:25184305-25184327 CCCATCTGATCACCTTCTCAGGG + Intergenic
928559749 2:32467987-32468009 AACTTCAGTTCACTTTCCCAAGG - Exonic
929367145 2:41173513-41173535 AGCCTCTGATCATTTTCCTTAGG - Intergenic
929597756 2:43186911-43186933 AGCCTCTTACCACTTTCCCCAGG - Intergenic
937890945 2:126938224-126938246 ACCATCTGATGACCTTACCAAGG - Intergenic
941012492 2:160317057-160317079 ACGCTCTATTCACTGTCCCAAGG + Intronic
941348863 2:164406490-164406512 ATCCACTGATCACTGTACCAGGG + Intergenic
944140156 2:196447625-196447647 AGCCTCTGTTAACTTTCCCATGG - Intronic
944779256 2:203001138-203001160 ACCTTCTGATATCTTCCCCAGGG - Intronic
947355258 2:229287963-229287985 AGTCACTGATAACTTTCCCATGG - Intergenic
1170120038 20:12901539-12901561 ACCCTCAGCTCACTTGCTCAGGG - Intergenic
1170797620 20:19562992-19563014 ACCCCCTGAGCACCTTCTCAGGG + Intronic
1170822029 20:19762375-19762397 CCTCTTTGATCACTTTCCGAAGG - Intergenic
1179117761 21:38509694-38509716 AACCTCAGATTACTTTCCCAAGG + Intronic
1179497701 21:41784199-41784221 CCTCACTGGTCACTTTCCCAAGG - Intergenic
1179801174 21:43812120-43812142 TTCCTCTGTTCTCTTTCCCAGGG + Intergenic
1181040790 22:20191769-20191791 CCCCTCTGATCGCTGTCACAGGG + Intergenic
1181936435 22:26442214-26442236 ATGATCTGATCACTTTCCAAAGG + Intronic
1182038485 22:27217995-27218017 GGGCTCTGATCACTTTCCCTGGG + Intergenic
1184630162 22:45771101-45771123 AACCTCTTTTCACTTTTCCAGGG - Intronic
1185156378 22:49195768-49195790 TCTCTCTGAGCACCTTCCCAAGG - Intergenic
949691714 3:6648107-6648129 ACCTTTTGGTCATTTTCCCAAGG - Intergenic
950020731 3:9785855-9785877 CTCTTCTGATCACTTTCCCCTGG - Intronic
951160054 3:19408015-19408037 ACTCTCTGCTCACTCTCCAAGGG - Intronic
955003453 3:54948161-54948183 ACCCCCAGCTCACTTTCCCCTGG + Intronic
955677207 3:61461267-61461289 ACCCTGTGATCTCTGTCTCAAGG + Intergenic
956468168 3:69539572-69539594 ATCTTCTGAGAACTTTCCCATGG + Intronic
956575450 3:70747548-70747570 AGGCTCTGATAACTTTCCCAAGG + Intergenic
959213986 3:103425624-103425646 GGCTTCTGATAACTTTCCCATGG - Intergenic
960079382 3:113525128-113525150 ACCCTTTGAACACTTTCAGATGG - Intergenic
964068069 3:152600736-152600758 AGCCTCTGTTCACTTTCACTTGG + Intergenic
965211441 3:165794629-165794651 ATCACCTAATCACTTTCCCAAGG + Intronic
965430010 3:168574669-168574691 ACCCCCAGCTTACTTTCCCAAGG - Intergenic
966822214 3:183933970-183933992 AGCCTATGATGAGTTTCCCAAGG - Intronic
970526360 4:16936476-16936498 ACCCTCTGATCTCTGCCCCTTGG - Intergenic
972356225 4:38281438-38281460 ACCCACAGCTCACTTTCACAGGG - Intergenic
972789817 4:42360602-42360624 ATCTTCTGTTCACTTTCCCCAGG - Intergenic
973262926 4:48182907-48182929 ACCCTCTTGTCCTTTTCCCAAGG + Intronic
979396493 4:120196002-120196024 ACCCTCAGAGCACCTTCCAAAGG + Intergenic
979906577 4:126300794-126300816 ACCCTCCCATCACTGGCCCAGGG - Intergenic
981397739 4:144273993-144274015 ACCCTCTGGTGACATTTCCATGG - Intergenic
983684705 4:170394646-170394668 CCCCTCTGATGCCTTTCCTATGG - Intergenic
984727513 4:183035845-183035867 ACCCTCCTGTCACTTTCCCTTGG + Intergenic
985053170 4:186013022-186013044 AACCTGTCCTCACTTTCCCATGG - Intergenic
985053657 4:186017529-186017551 CCCCTCTGCTCCCTTCCCCAGGG - Intergenic
986919412 5:12664960-12664982 AGCCTCTGTTCACTTTCACTTGG - Intergenic
988258208 5:28848851-28848873 ACCCTCTGATCAGTTCACAAAGG + Intergenic
989182619 5:38593703-38593725 ACAATCTAATCACTTCCCCAAGG - Intronic
990204366 5:53413459-53413481 ACCATCTGATCCCTTTCCCCTGG + Intergenic
997157474 5:131575158-131575180 AACCTCTTTTCACTTTCACATGG + Intronic
999495865 5:152096153-152096175 AGTCTCAGATGACTTTCCCAGGG - Intergenic
1000397230 5:160788572-160788594 ACCCTCTGGACTCTCTCCCAGGG - Intronic
1000637288 5:163658954-163658976 CTCCTCTGATCACTTTCACCAGG - Intergenic
1001942640 5:175751444-175751466 TCCCTCTGGTTACATTCCCAGGG - Intergenic
1003861998 6:10330884-10330906 CCCCTCTGATTACTTTCTTATGG - Intergenic
1004126917 6:12883036-12883058 AGCCTCTGATTACTTCCCCCAGG - Intronic
1004197854 6:13521390-13521412 TCCCCCTCATCACTTTCCTAAGG + Intergenic
1005979712 6:30827698-30827720 ACACTCTAATCACTTTCTCAAGG + Intergenic
1006117302 6:31782074-31782096 GCCCTCTGCTCACCTCCCCAGGG + Exonic
1009037348 6:58133774-58133796 ACCCACTGATGTCTTTCTCAAGG + Intergenic
1009213142 6:60887397-60887419 ACCCACTGATGTCTTTCTCAAGG + Intergenic
1011473370 6:87729663-87729685 ACCCTCAGATACCTTTTCCATGG - Intergenic
1011525806 6:88263720-88263742 TCCCTCTGTGCTCTTTCCCACGG - Intergenic
1011998120 6:93619093-93619115 ATCCTTTGCTCACTTTTCCATGG - Intergenic
1012419548 6:99048865-99048887 ACCTTCTTATCAGTTTTCCAAGG - Intergenic
1013650660 6:112191514-112191536 GCCCCCTTGTCACTTTCCCAGGG - Intronic
1014549844 6:122778096-122778118 ACCTTGGGACCACTTTCCCAAGG + Intergenic
1017083090 6:150687023-150687045 ACCCTCTGAACCCTTTACAAAGG - Intronic
1018335259 6:162779928-162779950 ACCCTCTGAAAACTTTTCCCAGG - Intronic
1019814775 7:3191503-3191525 ACCCTTTGATTTCTTGCCCAGGG + Intergenic
1021393795 7:20123883-20123905 AGCCTCTGTTCACTTTCACTTGG + Intergenic
1024193569 7:47036693-47036715 ACCCTTTGATCACTCACTCATGG - Intergenic
1024458095 7:49631661-49631683 ACCCTCTGAACACTGTCCTTGGG - Intergenic
1024843214 7:53611753-53611775 ACCCTCAGCCCATTTTCCCAGGG + Intergenic
1024906988 7:54394368-54394390 ACCATCTTATTACTTTCTCATGG - Intergenic
1026574440 7:71560495-71560517 ACCCTCCTGTCACTTTCCCACGG - Intronic
1027706605 7:81541925-81541947 ATCCTCTGATCAAATTCTCAGGG - Intergenic
1028048347 7:86152070-86152092 CCCCTCTCATCACAGTCCCAGGG + Intergenic
1029488713 7:100858746-100858768 ACCCTCTCCACACATTCCCACGG - Intronic
1030294231 7:107904671-107904693 ATCCTCTGAACACTTTACGATGG - Intronic
1031661288 7:124428324-124428346 ACCCTATAATCATTTTTCCATGG - Intergenic
1032062425 7:128736150-128736172 ACCCTCCTGTCACTTTCCCCTGG + Intergenic
1032091178 7:128912422-128912444 GCCCTCATATCACATTCCCAGGG + Intergenic
1035088162 7:156279136-156279158 GCCCTCTGATCTCCTGCCCAGGG + Intergenic
1035266195 7:157691486-157691508 CCCCTCTGCTCACTTTACCAGGG + Intronic
1036389652 8:8313572-8313594 ACCTCCTGACCACTTTCCCGGGG + Intergenic
1036651572 8:10647243-10647265 GCCCTCTGACCTCCTTCCCAGGG + Intronic
1039562285 8:38522293-38522315 ACCCTCTGTTCCCATTGCCAAGG - Intronic
1043767081 8:84149708-84149730 ACCATGTGATCTCTTTCACATGG + Intergenic
1047445217 8:124913428-124913450 ACCCTCTAATCCCTGACCCAAGG - Intergenic
1047578005 8:126179671-126179693 GCTCTCTGAACTCTTTCCCATGG + Intergenic
1048172548 8:132121534-132121556 CCCCTCTGAATACTTTTCCAAGG - Exonic
1048810428 8:138280814-138280836 ACCCTCCTGTCACTTTCCCTTGG - Intronic
1049546779 8:143235764-143235786 ACCCTCTGGTCACTTGCTCTGGG - Intergenic
1049733433 8:144191001-144191023 ACCCTCTGATCAATTTGCCACGG - Intronic
1055676090 9:78663054-78663076 ACTCTCTTATCACGTTCCCAGGG + Intergenic
1056750260 9:89345511-89345533 ACCCTTTGGTCACTTTCCAGAGG + Intronic
1060779224 9:126399446-126399468 ACCATCTGATCACATGCCCAAGG - Intronic
1188645213 X:32557745-32557767 ACCATCTGATCTTTTGCCCAAGG - Intronic
1188771285 X:34157698-34157720 GCCCTCTGTTCACTATCACACGG + Intergenic
1190774397 X:53541070-53541092 ACCCTCATAACACATTCCCATGG - Intronic
1194834541 X:98665623-98665645 AGCCTCTGAACACATCCCCAGGG + Intergenic
1198401995 X:136277657-136277679 ACCCTCTGATCTCCTTCCCCTGG + Intergenic
1201985111 Y:19957357-19957379 ACCCTCTGTTCTCATTCACATGG - Intergenic