ID: 1166255137

View in Genome Browser
Species Human (GRCh38)
Location 19:41599015-41599037
Sequence TGGATTTACTCCCAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166255137_1166255145 26 Left 1166255137 19:41599015-41599037 CCTCCCTGCTGGGAGTAAATCCA 0: 1
1: 1
2: 3
3: 24
4: 175
Right 1166255145 19:41599064-41599086 GGAAAACCTTGCATACCCAGAGG 0: 1
1: 0
2: 1
3: 12
4: 136
1166255137_1166255146 27 Left 1166255137 19:41599015-41599037 CCTCCCTGCTGGGAGTAAATCCA 0: 1
1: 1
2: 3
3: 24
4: 175
Right 1166255146 19:41599065-41599087 GAAAACCTTGCATACCCAGAGGG 0: 1
1: 0
2: 2
3: 8
4: 128
1166255137_1166255147 28 Left 1166255137 19:41599015-41599037 CCTCCCTGCTGGGAGTAAATCCA 0: 1
1: 1
2: 3
3: 24
4: 175
Right 1166255147 19:41599066-41599088 AAAACCTTGCATACCCAGAGGGG 0: 1
1: 0
2: 2
3: 10
4: 154
1166255137_1166255143 5 Left 1166255137 19:41599015-41599037 CCTCCCTGCTGGGAGTAAATCCA 0: 1
1: 1
2: 3
3: 24
4: 175
Right 1166255143 19:41599043-41599065 CCCAGACATTAGAAAACATGAGG 0: 1
1: 0
2: 2
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166255137 Original CRISPR TGGATTTACTCCCAGCAGGG AGG (reversed) Intronic
900572029 1:3363385-3363407 GGAATTTCCTCCCAGCAGGGAGG + Intronic
900928976 1:5724355-5724377 TGGATTTACATCCAGAAGTGGGG + Intergenic
902811196 1:18888988-18889010 TGGATAAACTCCAAGCATGGGGG + Intronic
910429156 1:87144142-87144164 TGGTCTTACTCCCAGCATGGTGG - Intronic
910720427 1:90280319-90280341 TGGGTTTTCTCACAGCATGGAGG + Intergenic
910988350 1:93028249-93028271 TGCATGTACTCCCTGCAGGAGGG - Intergenic
911170432 1:94765663-94765685 TGGATTTCCTCACAACATGGTGG - Intergenic
911993859 1:104737431-104737453 TGGCTATACTCCCAGCAATGTGG + Intergenic
913243751 1:116853060-116853082 TGGAGTCTGTCCCAGCAGGGAGG + Intergenic
913322460 1:117598674-117598696 TTAATCTGCTCCCAGCAGGGAGG - Intergenic
914198213 1:145461445-145461467 TGCCTGTAATCCCAGCAGGGAGG - Intergenic
914477316 1:148034574-148034596 TGCCTGTAATCCCAGCAGGGAGG - Intergenic
914747722 1:150511921-150511943 TGGACGCACTCACAGCAGGGGGG - Intronic
915732132 1:158061198-158061220 TCGATTTACTCCCAGCAAGAGGG - Intronic
916179970 1:162074857-162074879 TGGATTTCCTCACAGCATGGTGG + Intronic
917034746 1:170735952-170735974 TGGATGTACTCTCAGCATGGGGG - Intronic
917211613 1:172637569-172637591 TGGACTTCCTCACAGCATGGAGG + Intergenic
917983748 1:180293865-180293887 TGCCTTTAGTCCCAGCTGGGAGG - Intronic
918439795 1:184555667-184555689 TGGCTTTACTCTCAGGAGCGGGG + Intronic
920457716 1:206113702-206113724 TGGCTTTACTCCCAACATTGTGG - Intronic
923770071 1:236930676-236930698 TGGATATAGTCCCAGCAGGCAGG - Intergenic
1066010109 10:31187241-31187263 TGGAAATACTCCAAGCATGGTGG + Intergenic
1067753455 10:48986562-48986584 TGGAGTTCCTCCCAACAGAGTGG - Intergenic
1069490443 10:68856317-68856339 TGCATTTCCTCCAAGCAGGGAGG - Intronic
1070575320 10:77672985-77673007 TGAATTGACTCTCAGCAAGGTGG - Intergenic
1072551012 10:96477790-96477812 GGGCTTTGCTCCCAGAAGGGTGG - Intronic
1072857139 10:98960029-98960051 TGGATATAATCTCAGCAGGAAGG - Intronic
1073286977 10:102395380-102395402 GGGATTTTCTGCCAGGAGGGAGG - Intronic
1074151468 10:110763250-110763272 TGAATTCAGTCCCAGCAGGAGGG + Intronic
1074775278 10:116763566-116763588 TGGAACTGCCCCCAGCAGGGTGG + Intergenic
1074992687 10:118724381-118724403 TGTAATTGCTCTCAGCAGGGGGG + Intronic
1075563063 10:123482403-123482425 TGGGTTTAATCCCAGCTGGGTGG + Intergenic
1075677406 10:124304887-124304909 AGGATGTACACCCAACAGGGAGG + Intergenic
1077753659 11:5002510-5002532 TGGACTTACTGCCAGCAGCTGGG - Intergenic
1079476896 11:20840587-20840609 TGGACTTCCTCACAGCAAGGTGG + Intronic
1084361827 11:68673726-68673748 TGGACTTCCTCCCAGTATGGTGG - Intergenic
1086007385 11:82053646-82053668 TGGGTATACACCCAGCAGTGAGG - Intergenic
1086055673 11:82643277-82643299 TGGATTTTATCTCAGCAGGTCGG + Intergenic
1089070277 11:115694633-115694655 TGGATTTTCTCCCACTAGGGAGG + Intergenic
1091085525 11:132718514-132718536 TGGATTTACTCTCACGACGGTGG + Intronic
1091688684 12:2581408-2581430 TGAATTAACTCCCTCCAGGGTGG + Intronic
1093308624 12:17550084-17550106 AGGATTTACTCCTAGCATGTGGG + Intergenic
1093535080 12:20213067-20213089 TGGTTTTACACCCACCAGGGAGG - Intergenic
1095527658 12:43147088-43147110 TGGGCTTCCTCGCAGCAGGGTGG + Intergenic
1097768204 12:63549851-63549873 TGGATTTAAAGCCAGCAGGTTGG + Intergenic
1097784564 12:63744914-63744936 TGGATTTAAAGCCAGCAGGTTGG + Intergenic
1098482174 12:70976545-70976567 TGGACTTCCTCACAGCATGGTGG - Intergenic
1102760522 12:115380913-115380935 TGGAGATACTCTCAGCAAGGGGG - Intergenic
1102841894 12:116133822-116133844 TAGGTTTCCTCACAGCAGGGTGG - Intronic
1104111718 12:125710708-125710730 GGGGTTCACTCACAGCAGGGAGG - Intergenic
1105783695 13:23726621-23726643 TGGATTTATTCCCATCATAGGGG + Intergenic
1108667163 13:52644224-52644246 AGGATTTATTCCCAGCCGTGTGG - Intergenic
1108836125 13:54551574-54551596 TGTATTTACATCCAGCATGGTGG + Intergenic
1108976896 13:56456120-56456142 TGGATTTACTCCCAGAATAGAGG - Intergenic
1109198888 13:59409416-59409438 TGGATTTCCTCCCAGCTGCAGGG + Intergenic
1111834642 13:93373038-93373060 TGGAGTTGCATCCAGCAGGGTGG - Intronic
1115734087 14:36305091-36305113 TGCATGTACTCCCAGCATGATGG + Intronic
1117270138 14:54135217-54135239 TGGGTTTACTTACAGCATGGTGG - Intergenic
1117670275 14:58099371-58099393 TGGATTTTCTCCCACCCTGGTGG - Intronic
1120658809 14:87228733-87228755 TGGATTTTTCCCCAGGAGGGTGG - Intergenic
1121077923 14:91084708-91084730 TGGAATGACTTCCAGCATGGAGG + Intronic
1122904441 14:104795429-104795451 TGGATTTCCTCCCCGCGGGCCGG - Intronic
1123203092 14:106685821-106685843 TGGGTATATTCCCAGAAGGGAGG - Intergenic
1123411853 15:20067453-20067475 TGGCTCTGTTCCCAGCAGGGAGG - Intergenic
1123521197 15:21074572-21074594 TGGCTCTGTTCCCAGCAGGGAGG - Intergenic
1123578280 15:21694654-21694676 TGGCTCTGTTCCCAGCAGGGAGG - Intergenic
1123614905 15:22137136-22137158 TGGCTCTGTTCCCAGCAGGGAGG - Intergenic
1124193832 15:27603185-27603207 TGGATTAACTCCCACCAGAGTGG + Intergenic
1125041427 15:35191602-35191624 TGGTTTTAATCTCAGCAGTGGGG - Intergenic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1128550497 15:68595316-68595338 AGGATTTCCTCCCAGGAAGGGGG + Intronic
1129096129 15:73210297-73210319 TGCATTTACTCCCAGGAGCCTGG + Intronic
1131777234 15:95815755-95815777 TGGATCTTCACCCAGCATGGGGG + Intergenic
1202987150 15_KI270727v1_random:428899-428921 TGGCTCTGTTCCCAGCAGGGAGG - Intergenic
1133890138 16:9871168-9871190 TGGATTGACTCAGAGCTGGGTGG - Intronic
1139188627 16:64836270-64836292 AGGATTTCCTCCCAGCTGTGAGG - Intergenic
1139300518 16:65941777-65941799 TGGGTTTAATCCCAGCTGTGTGG - Intergenic
1141475555 16:84270763-84270785 TGGACTTCCTCACAGCATGGCGG + Intergenic
1142864740 17:2783889-2783911 TGGGCTTCCTCCCAGCATGGTGG + Intronic
1144208934 17:12998768-12998790 TGGATTTGTTCCCAGGAGAGGGG + Intronic
1149681846 17:58512907-58512929 TGGATGTACTCCAGGCTGGGGGG + Exonic
1152928643 17:83099247-83099269 CGGGTTTAATCCCAGCAGGCAGG - Intergenic
1155740943 18:29286902-29286924 TGCATTTCCTCCAAGCAAGGGGG + Intergenic
1158077577 18:53548429-53548451 TGGATTCACTACCAGAAGGAAGG + Intergenic
1159893879 18:73978693-73978715 TGGACTTCCTCACAGCATGGTGG - Intergenic
1159965713 18:74594096-74594118 TGGATGTAGTCCCAACAGAGTGG - Intergenic
1160323062 18:77914498-77914520 TTGATTTTCTCGCAGCACGGAGG + Intergenic
1161119715 19:2518611-2518633 TTGCTTTGCTCCCAGCGGGGAGG - Intronic
1163276914 19:16290662-16290684 TGGATTGAGTCCCAGCAGGTGGG - Intergenic
1164521539 19:28983715-28983737 TCCATATACTCCCAGCAGGGAGG - Intergenic
1165187333 19:34033279-34033301 TGGCTTTTCTCCCAGCAGCTTGG + Intergenic
1166255137 19:41599015-41599037 TGGATTTACTCCCAGCAGGGAGG - Intronic
1166261055 19:41641064-41641086 TGGATTTACTCCCAACAAGGAGG + Intronic
1166276063 19:41755139-41755161 TGGATTTACCTCCAGCAAGGAGG - Intronic
1166281314 19:41796188-41796210 TGGATTTACTCCCAGCAAGGAGG - Intergenic
1166412108 19:42562186-42562208 TGGATTTCCTCCCAGCAAGGAGG + Intergenic
1167955730 19:53062345-53062367 TGGCTCTCCTCCCAGCAGAGTGG - Intergenic
925252133 2:2448650-2448672 TGGTTGTACTCCCACCAGGCAGG + Intergenic
925992919 2:9268468-9268490 TGGCTTTATTCCCACAAGGGGGG + Intronic
927207937 2:20621756-20621778 TGGATTTGCTCCCAGGTGGGTGG + Intronic
929431704 2:41893018-41893040 TGGATTTCCTTCCTGAAGGGAGG - Intergenic
931264910 2:60652098-60652120 TGGGTTTCCTCGCAGCATGGTGG + Intergenic
935328902 2:101962108-101962130 TGGAATTGCTCCCAGCCGGGTGG - Intergenic
935625572 2:105169762-105169784 TGCTTTTCCTCCCTGCAGGGTGG + Intergenic
936508556 2:113127699-113127721 TGGATTTTCTCCCAGAGGGTCGG - Exonic
936531711 2:113280654-113280676 AGGATTCCCTCCCACCAGGGAGG + Intergenic
938337801 2:130514700-130514722 TGACCTTATTCCCAGCAGGGTGG + Intergenic
938352038 2:130606035-130606057 TGACCTTATTCCCAGCAGGGTGG - Intergenic
942425302 2:175853851-175853873 TTGATTGACTCTCAGCAGGACGG - Intergenic
944350695 2:198723750-198723772 TGGATTTACTGTCATCTGGGTGG - Intergenic
944923519 2:204439286-204439308 TGGACTGCCTCCCAGCATGGTGG + Intergenic
945515007 2:210752706-210752728 TGGATTTACTCTCAGCGAGGTGG - Intergenic
945801325 2:214434967-214434989 TGTATTTACTGCCAGTATGGGGG - Intronic
946486944 2:220109865-220109887 AGGGTTTCCTCCCAGCATGGTGG - Intergenic
947808731 2:232986348-232986370 TGGATTTATTTCCAGAAGTGGGG - Intronic
948039129 2:234885355-234885377 TCTTTTTACTCCCAGCAGGAGGG + Intergenic
948882734 2:240868785-240868807 TGGAATATTTCCCAGCAGGGCGG - Exonic
1169000347 20:2163703-2163725 TGGTTTTCCTCCAAGTAGGGAGG + Intronic
1169668913 20:8072658-8072680 TGTCTGTAATCCCAGCAGGGAGG - Intergenic
1173643052 20:44616833-44616855 TGCTTTTATTCCCAGCGGGGTGG - Intronic
1174544964 20:51318375-51318397 TGGGTTTCCTCACAGCACGGTGG - Intergenic
1174647926 20:52102080-52102102 TGGAGTTACTCTCACCAGGCTGG - Intronic
1178370346 21:32021872-32021894 GGGGTTTACGGCCAGCAGGGAGG - Intronic
1178920485 21:36735324-36735346 TGGATGAAGGCCCAGCAGGGAGG - Intronic
1180297954 22:10961635-10961657 GGGCTTTACTCCCGTCAGGGAGG - Intergenic
1185011783 22:48318691-48318713 TGGGTATACACCCAGCAGTGGGG + Intergenic
1185039986 22:48498882-48498904 TGGACTCAATACCAGCAGGGTGG + Intronic
949573972 3:5320789-5320811 TGGGCTTCCTCCCAGCATGGTGG + Intergenic
949675054 3:6444148-6444170 TGGTTTTACTACCAGGAGGGAGG + Intergenic
950532619 3:13561299-13561321 TGGATGTTGTCCCAACAGGGTGG - Intronic
951919108 3:27834038-27834060 TGGACTTCCTCACAGCATGGTGG + Intergenic
952998074 3:38904663-38904685 AGGATTTACTCCCTGCAAGGGGG - Intronic
953750942 3:45607867-45607889 TGGATTTCCTTTCAGCAGGGTGG + Intronic
960157625 3:114312445-114312467 TTCATTTACTCCCAGATGGGTGG + Intergenic
960635495 3:119780846-119780868 GGGACTTACTGCCAGCAGTGGGG - Intronic
961103412 3:124221080-124221102 TGGTCTGACTCCCAACAGGGTGG - Intronic
961509680 3:127393228-127393250 TGGACTTCCTCTCAGCATGGTGG - Intergenic
962088721 3:132220353-132220375 TGGATGTACTGCCTCCAGGGTGG - Intronic
962312234 3:134334761-134334783 TGGATTCACTGCCAGCAGAAGGG - Intergenic
967286343 3:187874292-187874314 TGGATGTAATCCTAGTAGGGCGG + Intergenic
967846938 3:194051701-194051723 TGAATATACTCCCAGCATTGGGG - Intergenic
968892479 4:3377095-3377117 TTGATTTTCTTCCAGCAGGAAGG + Intronic
969219869 4:5752544-5752566 TGGATTCCCTCCTAGGAGGGTGG + Intronic
969532561 4:7737962-7737984 TGGGCTTCCTCCCAGCATGGCGG + Intronic
969883217 4:10192896-10192918 TGGATGTACTCCAAGCACAGTGG + Intergenic
970032243 4:11689430-11689452 TGGATTTACTGCGAACAGGAAGG - Intergenic
971213823 4:24645128-24645150 TGTTTTTACTTCCAGCAGAGAGG + Intergenic
972410777 4:38792182-38792204 AGGATTTAATCCCAGCATGCCGG + Intronic
973260096 4:48154710-48154732 TGGAACTTGTCCCAGCAGGGAGG + Intronic
976121047 4:81782001-81782023 TGGATTTACTCTCTACAGGTAGG + Intronic
976123363 4:81806775-81806797 TGGAATTACTCCCATCAGAAAGG - Intronic
980433492 4:132737345-132737367 TGGAATAACTCTCAGCAGAGAGG - Intergenic
981880902 4:149611321-149611343 TGGATATATACCCAGCAGTGGGG - Intergenic
983561944 4:169110242-169110264 TGCCTTTAGTCCCAGCTGGGAGG + Intronic
983982229 4:174012469-174012491 GGGATTTACTCTCATTAGGGAGG + Intergenic
987034174 5:14003815-14003837 TGGGCCTGCTCCCAGCAGGGTGG - Intergenic
988577843 5:32444257-32444279 TGGATTCACCCACAGCGGGGCGG - Exonic
992237366 5:74724876-74724898 TGGATTAACTCCCAGGAGTGTGG - Intronic
992506842 5:77395440-77395462 TGGAATTTGTCCCAGCAGGGTGG - Intronic
997603841 5:135158668-135158690 GGGGTTTACTCCCAGCATGAGGG - Intronic
1001547018 5:172576586-172576608 AGGATCTCCTACCAGCAGGGTGG + Intergenic
1003256612 6:4480740-4480762 TGGATCCCCTCCCATCAGGGAGG + Intergenic
1003509452 6:6767436-6767458 TGCCTGTAATCCCAGCAGGGAGG - Intergenic
1003554092 6:7124661-7124683 TAGAAATACTCCCAGCATGGTGG + Intronic
1004099122 6:12591059-12591081 TGGTTTTACTCCCAGTCTGGTGG - Intergenic
1011842737 6:91522121-91522143 TGGATTTCCTCACAGCATGGAGG - Intergenic
1017986240 6:159445412-159445434 TGGGCTTCCTCCCAGCATGGTGG - Intergenic
1018229965 6:161666022-161666044 TGGATTCCATCCCAGCTGGGCGG + Intronic
1018666561 6:166143722-166143744 TGGCTCTGCTCCAAGCAGGGTGG - Intergenic
1018668709 6:166162616-166162638 TGTCTTTTCTCACAGCAGGGGGG - Exonic
1019348276 7:541212-541234 TGGGCTTCCTCCCAGCATGGTGG - Intergenic
1021826760 7:24561210-24561232 TGGAATGACTCCCAGATGGGAGG - Intergenic
1023347441 7:39285898-39285920 AGCATTTATTCCCAGAAGGGAGG + Intronic
1023845469 7:44117706-44117728 TGTATTTACTCCGAGGAGGCTGG + Exonic
1024480385 7:49856087-49856109 TGCATTGCCTCCCAGTAGGGTGG - Intronic
1029234213 7:99099716-99099738 TGGATTCATTCCCAAGAGGGTGG + Intronic
1029803883 7:102976596-102976618 TGGAATTACCCCAAACAGGGGGG - Intronic
1031972906 7:128076876-128076898 AGGAATTACACTCAGCAGGGAGG - Intronic
1032955613 7:136968514-136968536 TGGATATACACCCAGAAGTGGGG - Intronic
1033023977 7:137754831-137754853 TGGTTTGACTCACAGCAGAGGGG + Intronic
1035608495 8:945275-945297 TAGATCCACTCCCAGGAGGGAGG - Intergenic
1036408783 8:8479214-8479236 TGGATTCTTTTCCAGCAGGGTGG - Intergenic
1037859647 8:22396005-22396027 GGGATTTAGTCCCTGCAGTGTGG + Intronic
1038397303 8:27256833-27256855 TGGATGGCCACCCAGCAGGGAGG - Intronic
1040440130 8:47432823-47432845 TGGATTTAATCCAGTCAGGGTGG + Intronic
1042589911 8:70387822-70387844 TGGACTTCCTCACAGCATGGCGG - Intronic
1044953170 8:97453001-97453023 TGTATTTCCTCCCAGAAGTGAGG - Intergenic
1045400488 8:101811718-101811740 TGGGTTCACTCCCAGCTGGAAGG - Intronic
1046367565 8:113256076-113256098 TGGATTCACTACCAGCATGTAGG - Intronic
1047936406 8:129784731-129784753 TGGGTGTACACCCAGCAGAGAGG - Intronic
1054730866 9:68701894-68701916 TGGGCTTCCTCCCAGCAAGGTGG - Intergenic
1055162434 9:73146506-73146528 TGGATATATACCCATCAGGGTGG - Intergenic
1056809191 9:89751073-89751095 TGGACTTTCTCACAGCATGGTGG + Intergenic
1058161801 9:101578441-101578463 TGGATTACCTCCCAGCAGGGAGG - Intronic
1058629757 9:106974444-106974466 AGGAAATACTCCCAGCAGGAAGG - Intronic
1061398346 9:130355368-130355390 TGGGTATGGTCCCAGCAGGGCGG + Intronic
1187572812 X:20521894-20521916 TGGGTTTCCTCACAGCATGGTGG + Intergenic
1188526852 X:31096712-31096734 TGGATATATACCCAGCAGTGGGG - Intergenic
1188775110 X:34207264-34207286 AGGATTTGATCCCAGCAGTGTGG + Intergenic
1189353093 X:40291806-40291828 TGGACTTGCTCACAGCATGGTGG - Intergenic
1191945755 X:66533555-66533577 TTGGTATACTCCCAGCAGTGGGG + Intergenic
1197813322 X:130470034-130470056 TGGATTTCTGTCCAGCAGGGTGG + Intergenic
1199253002 X:145686151-145686173 TGGAATTTCTCACTGCAGGGAGG - Intergenic
1199318424 X:146409125-146409147 TGGATATACACCCAGAAGTGAGG - Intergenic