ID: 1166256057

View in Genome Browser
Species Human (GRCh38)
Location 19:41605695-41605717
Sequence GCTGAACTGACCGCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166256057_1166256058 -6 Left 1166256057 19:41605695-41605717 CCTGCAGCAGCGGTCAGTTCAGC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1166256058 19:41605712-41605734 TTCAGCTGCTACCACTGCACAGG 0: 1
1: 1
2: 0
3: 20
4: 153
1166256057_1166256061 11 Left 1166256057 19:41605695-41605717 CCTGCAGCAGCGGTCAGTTCAGC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1166256061 19:41605729-41605751 CACAGGCCATGGCTCCAGCTTGG 0: 1
1: 2
2: 2
3: 31
4: 297
1166256057_1166256059 0 Left 1166256057 19:41605695-41605717 CCTGCAGCAGCGGTCAGTTCAGC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1166256059 19:41605718-41605740 TGCTACCACTGCACAGGCCATGG No data
1166256057_1166256064 30 Left 1166256057 19:41605695-41605717 CCTGCAGCAGCGGTCAGTTCAGC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1166256064 19:41605748-41605770 TTGGCTCCCCTGCCACCACCAGG 0: 1
1: 0
2: 4
3: 26
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166256057 Original CRISPR GCTGAACTGACCGCTGCTGC AGG (reversed) Intronic