ID: 1166259298

View in Genome Browser
Species Human (GRCh38)
Location 19:41626863-41626885
Sequence CTCTGGGAGTGGTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 602}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166259298_1166259312 16 Left 1166259298 19:41626863-41626885 CCCTCTTCCCACCACTCCCAGAG 0: 1
1: 0
2: 1
3: 60
4: 602
Right 1166259312 19:41626902-41626924 GTGATCAGGAGCCCCTGCCAGGG 0: 1
1: 3
2: 5
3: 18
4: 205
1166259298_1166259305 2 Left 1166259298 19:41626863-41626885 CCCTCTTCCCACCACTCCCAGAG 0: 1
1: 0
2: 1
3: 60
4: 602
Right 1166259305 19:41626888-41626910 TCCTCCCCTCACCTGTGATCAGG 0: 1
1: 2
2: 7
3: 39
4: 254
1166259298_1166259311 15 Left 1166259298 19:41626863-41626885 CCCTCTTCCCACCACTCCCAGAG 0: 1
1: 0
2: 1
3: 60
4: 602
Right 1166259311 19:41626901-41626923 TGTGATCAGGAGCCCCTGCCAGG 0: 1
1: 3
2: 14
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166259298 Original CRISPR CTCTGGGAGTGGTGGGAAGA GGG (reversed) Intronic
900484159 1:2913640-2913662 CTCCAGGGGTGGTGGGAGGAAGG - Intergenic
900506165 1:3030684-3030706 CACTTGGACTGGTGGGATGAGGG + Intergenic
900619449 1:3580235-3580257 GTCTGAGAGGGGTGGGAGGAGGG + Intronic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901249886 1:7770141-7770163 CTCTGGCAGTAGTGGCCAGATGG - Intergenic
902287689 1:15417195-15417217 CTCAGGAAGTGGTGGGGAGACGG - Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902803696 1:18847514-18847536 GTCGGGGACTGGGGGGAAGAGGG + Intronic
902822993 1:18954928-18954950 CTCAGGGAGTGGGGAGAAGAGGG + Intronic
902923653 1:19681859-19681881 CTCTGGGGGAGGTGGGAGGAGGG - Intergenic
903276166 1:22223357-22223379 CCCTGGGAGTTGGGTGAAGAGGG + Intergenic
903344373 1:22675075-22675097 CTGTGGCAGCGGTGAGAAGATGG - Intergenic
903680503 1:25093277-25093299 CTCTGGGACTGGTGGGCTGGGGG - Intergenic
903993702 1:27291510-27291532 CTCAGAGAGTGGTGGGTAGGGGG - Intronic
904163446 1:28537683-28537705 CTCTGGGAGTTCAGGGAAGTTGG - Intronic
904206082 1:28856121-28856143 CCCTTGGGGTGGTGGAAAGAGGG + Intronic
904260116 1:29283332-29283354 CTATGGGAGGGGTGGGACCATGG - Intronic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905690042 1:39936413-39936435 CTCAGGCAGAGGTGGGAGGAAGG + Intergenic
906199025 1:43947485-43947507 CCCAGGGAGTGGTGGGGTGAGGG - Exonic
906275332 1:44511004-44511026 CTCTCGCAGTGGGGGGATGACGG + Intronic
906609652 1:47192547-47192569 CTTTGGGAGTGGTGGGGGAAGGG + Intergenic
907042013 1:51269844-51269866 CCCTGGGAGGGGTAGGAAGCTGG - Intronic
907794026 1:57696329-57696351 CTGTGGGAGATGTGGGAAGCAGG + Intronic
908003121 1:59701110-59701132 CACTGGGAGTGCTGGGGATAGGG + Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908524645 1:64976065-64976087 CACTGGGAGTGATGGTAAGTGGG + Intergenic
909023716 1:70460401-70460423 CTCTTGGAGCTGTGAGAAGAGGG + Intergenic
911971160 1:104439664-104439686 CACTGGGAGTAATGGTAAGAGGG + Intergenic
912260612 1:108108551-108108573 CTCTGGGAGAGAGGGGAGGAGGG - Intergenic
912547946 1:110464898-110464920 CTCTGGGAGTGGGAGGTACAAGG - Intergenic
914804620 1:150983108-150983130 GTCTGTGACTGGCGGGAAGATGG + Exonic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915436631 1:155911450-155911472 ACCTGGGAGGGGCGGGAAGAGGG - Intergenic
915860248 1:159436543-159436565 ACCTGTGAGTGGTGTGAAGATGG - Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917047011 1:170872183-170872205 CTATGGAAGTGCTGGGAAAAGGG + Intergenic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
917623178 1:176818901-176818923 AATTGGGAGTGGTGGGGAGATGG - Intronic
918301902 1:183212316-183212338 CTCTGTGAGTGGTCAGCAGAAGG - Intronic
919885191 1:201928499-201928521 CTCTGTGAGTGCTGTGAAGAGGG + Intronic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
920397966 1:205660273-205660295 GGCTGGGGGAGGTGGGAAGAGGG - Intronic
920769030 1:208863023-208863045 CTCTGGGGGTTCGGGGAAGAAGG + Intergenic
920823232 1:209400945-209400967 CTCCGGGAGGGATTGGAAGATGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922095441 1:222439461-222439483 CACTGGGAATGGGGGGACGAGGG - Intergenic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923280430 1:232438101-232438123 CCCTGGCAGTGGTGGGGTGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923389886 1:233503732-233503754 CTCTGCCAGTGTTGGGAATATGG - Intergenic
924671874 1:246136545-246136567 ATCTGGGAGTTGGAGGAAGAAGG + Intronic
1062945952 10:1462150-1462172 GCCTGGGGGTGGTGGGAAGTGGG - Intronic
1063030284 10:2227757-2227779 CACTGGCAGTGGTAGGAGGAAGG + Intergenic
1063491820 10:6471022-6471044 GTCAGAGAGGGGTGGGAAGAGGG + Intronic
1063528151 10:6803580-6803602 CCCTGGGAGTGGTGGTATGTGGG - Intergenic
1065740033 10:28788931-28788953 CTCTGGGAGATGCGGGAACAAGG + Intergenic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1069086862 10:64150669-64150691 CTATGGGAGTGGTGTGGAGATGG + Intergenic
1069346463 10:67476424-67476446 GTCTGGGAGTGGGGTGGAGAGGG - Intronic
1069960026 10:72074005-72074027 CTCTGGGAGCTGGGGGGAGAGGG + Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070224139 10:74483001-74483023 CTATTGGAATGGTGAGAAGAGGG - Intronic
1070839784 10:79476194-79476216 CTCTGGAAGTGGGCTGAAGATGG + Intergenic
1070966204 10:80532827-80532849 CTCTGGCACTGGTGTGGAGAGGG - Exonic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071617795 10:87092898-87092920 ATAAGGGAGTGGTAGGAAGAAGG + Intronic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074289598 10:112128346-112128368 CACAGGGAGGGGTAGGAAGACGG + Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075190980 10:120308420-120308442 CTCTGGCAGGGGTGGGGATAAGG - Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076693292 10:132234642-132234664 CTTGGGGAGTGGTGGGATGCCGG + Intronic
1076752273 10:132549537-132549559 CTCCTGGAGGGGTGGGCAGAGGG - Intronic
1077348021 11:2073305-2073327 CACTGGGAATGATGGGAAGCGGG + Intergenic
1077931736 11:6739931-6739953 GTATGCGAGTGATGGGAAGATGG + Intergenic
1078395864 11:10981449-10981471 AGCAGGCAGTGGTGGGAAGAGGG - Intergenic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1080574205 11:33583504-33583526 ATATGGAAGTGGTGGGGAGAGGG + Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082766143 11:57169545-57169567 CTACTGGAGTTGTGGGAAGAGGG - Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083031323 11:59595443-59595465 CTCAGAGATTGGTGGGTAGAAGG - Intronic
1083194429 11:61075706-61075728 CGGTGGGAGTGATAGGAAGATGG + Intergenic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1083447889 11:62722195-62722217 CTCTTCTGGTGGTGGGAAGAAGG + Exonic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083746830 11:64741645-64741667 CTCTGGGAGGGGTTGGAGGTGGG + Intronic
1083853429 11:65380522-65380544 CTCTCGGAGAGGTGGGAACCTGG - Intronic
1084114123 11:67031905-67031927 TTCTGGGAGTCCTGGGAACAGGG - Intronic
1084591675 11:70094135-70094157 CCCTGGGAGTGGTGAGGAGTGGG - Intronic
1085012772 11:73152824-73152846 CACTGGGAGGGGTGGGGAGTAGG + Intergenic
1085322181 11:75582162-75582184 CTCTTGAAGTGGGGGGAAAAGGG - Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085504417 11:77048927-77048949 CTCTGGGAGTAGTGGGCCCAAGG - Intergenic
1085699002 11:78729685-78729707 CTCACCGAGTGGAGGGAAGATGG + Intronic
1087054457 11:93919992-93920014 CATGGGGAGTGGTGGGAGGATGG + Intergenic
1087762018 11:102111342-102111364 CTCTGGGAGGAGTGGGGAGCTGG - Intronic
1087948248 11:104191591-104191613 GTCTGGGAGTGGGATGAAGAAGG - Intergenic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1089504884 11:118956438-118956460 CTCTGGCAGGGGTGGGAAGGGGG + Intronic
1090837322 11:130462803-130462825 CTCGGGGACTGCTGGGAGGAGGG + Intronic
1090856367 11:130612382-130612404 CTCTTGGGGTGGAGGGATGAGGG - Intergenic
1091146222 11:133282614-133282636 CTAGTGGAGTTGTGGGAAGAGGG + Intronic
1091337443 11:134783029-134783051 CTTGGGGAGTGATGGGAAGAAGG - Intergenic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1093224340 12:16463432-16463454 CTCTGGGGGTGGGGGGAGGGAGG + Intronic
1093387552 12:18577060-18577082 TTCTGGGACTGGTGTGAAGAAGG + Intronic
1093536613 12:20230742-20230764 CTAGGGGAGTTGTGAGAAGAGGG - Intergenic
1094136167 12:27128877-27128899 CACTGGGTGTGGTGGAATGAGGG - Intergenic
1094185737 12:27640622-27640644 CACTGGGTGTGGTGGAATGAGGG - Intronic
1094725760 12:33114085-33114107 TCGAGGGAGTGGTGGGAAGAGGG + Intergenic
1095939529 12:47717057-47717079 CTCTGGGAGGAATTGGAAGAGGG + Exonic
1096589272 12:52646682-52646704 CTCTGGGAGAGATGAGAGGAAGG + Intronic
1097029966 12:56083075-56083097 CTCTGGCAGTGCTGGGGTGAGGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098512979 12:71341014-71341036 CTCTTGGTGGGGTGGGGAGAGGG - Intronic
1098871962 12:75826501-75826523 CTCTGGGATGGGTAGGAAGGAGG - Intergenic
1099243571 12:80167250-80167272 CCGTGGGAGTGGTGGGGAGGTGG + Intergenic
1099781350 12:87199907-87199929 CTCTGCTAGTGGTGGTAAAAAGG - Intergenic
1100297175 12:93273939-93273961 CCCTGGGAATGGTGGGAGGGAGG - Intergenic
1100686059 12:96986761-96986783 CTCTGAGAGTTGGGGGAAGTGGG + Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101044338 12:100789082-100789104 TTCCATGAGTGGTGGGAAGAAGG - Intronic
1101157053 12:101937773-101937795 CTCTGGGAGGGGTGGTGAAAAGG - Intronic
1101999689 12:109549273-109549295 ATCTCTCAGTGGTGGGAAGATGG - Intergenic
1102427892 12:112858795-112858817 CTCTGGAGGTGGTGAGAAGCAGG - Intronic
1102555491 12:113724004-113724026 CTCTGGGGGTTGTGGGGAGGTGG + Intergenic
1102620321 12:114189392-114189414 GTCTGGCAGAGGTGTGAAGATGG + Intergenic
1102686578 12:114729432-114729454 CTCTGGGAGTGGCTGGAGGGAGG + Intergenic
1102926372 12:116829344-116829366 CTCTGGAACTTTTGGGAAGATGG - Intronic
1104088509 12:125495137-125495159 TTCAGGGAGTAGGGGGAAGAGGG - Intronic
1104155238 12:126125296-126125318 CTCAGGGAGTGGTGAAGAGAAGG - Intergenic
1104596037 12:130120484-130120506 GTCTGGAAGTGCTGGGGAGAAGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105469194 13:20676499-20676521 CACTGGCAGTGGTGAGAACATGG - Intronic
1105917639 13:24931859-24931881 CTTTGGGAGAGGTGGGTGGATGG - Intergenic
1106295427 13:28409231-28409253 TTTTGAGTGTGGTGGGAAGAGGG - Intronic
1106359693 13:29019216-29019238 TGCAGGGACTGGTGGGAAGAGGG + Intronic
1106420382 13:29580941-29580963 CTCTGGCGGTGGTGGGAATGTGG - Intronic
1106593344 13:31116740-31116762 TACAGGGAGAGGTGGGAAGAGGG + Intergenic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1109221062 13:59641468-59641490 CTCAGGGAGTGGCTGGGAGAAGG - Intergenic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1109442628 13:62394909-62394931 CACTGTGGGTGGTGGGAAGGAGG + Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110511033 13:76350567-76350589 TTCTTGGAGTGGCGGGAAGGGGG + Intergenic
1110591928 13:77273156-77273178 CTCAGGGAAAGATGGGAAGAAGG + Intronic
1110654142 13:77976655-77976677 GTCTGGGAGAGGTGGGAATGGGG - Intergenic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1113645501 13:111992299-111992321 CCCTGGAAGTTGTGTGAAGAAGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1115850937 14:37589470-37589492 CTCTGGAGGAGGTGGGAGGAGGG - Intergenic
1115913326 14:38281093-38281115 CTCTGCAAGTGTTGGGTAGAAGG + Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118691432 14:68344127-68344149 CTTGTGGAGTGATGGGAAGAGGG + Intronic
1119149479 14:72345161-72345183 CTCTGTGAAAGGTGGGAAGGAGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121078766 14:91090704-91090726 CTCCAGGACTGATGGGAAGAAGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121649274 14:95545179-95545201 CGGTGGCAGAGGTGGGAAGAAGG + Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122746383 14:103899484-103899506 CTCCGGGTGGGGTGGGGAGATGG + Intergenic
1124218003 15:27825480-27825502 GGCTGGGAGTGGCGGGGAGAGGG + Intronic
1124230195 15:27938366-27938388 CTCTGCAAGTTGTGGGCAGAAGG - Intronic
1125437698 15:39665069-39665091 CGATGGGAGTGGTGGGAGAAGGG - Intronic
1125580694 15:40783395-40783417 CTCTGGGATGGGTGAGAGGAAGG + Intronic
1126378835 15:48025046-48025068 TACTGGTAGTGGTGGGAAGAGGG - Intergenic
1126522694 15:49614795-49614817 ATTAGGGAGTGGTGGTAAGAAGG - Intronic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1127827312 15:62715995-62716017 CCCTGGGAGAGATGGGGAGAGGG + Intronic
1128689767 15:69714562-69714584 CTCTCGGAGGGCAGGGAAGAGGG + Intergenic
1128733127 15:70034266-70034288 CTCTGGGAATGGTGCAGAGAGGG + Intergenic
1128995458 15:72291293-72291315 CTCTGGGAGCGTGGGGTAGAGGG + Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1129506661 15:76087190-76087212 CTTTGGAAGTGGTGTGGAGAAGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129702170 15:77774330-77774352 CCCTGGGAGAGGTGGGCAGAGGG - Intronic
1129859693 15:78851059-78851081 CTCTGGAAGGGGTGGGCAGCAGG - Intronic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1130381934 15:83379046-83379068 ACCTGGGAGTGGTGGGGGGAGGG + Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133101423 16:3482396-3482418 CTCTGGCTGTCGTGGGAAGTCGG + Intronic
1133129179 16:3665694-3665716 CCCAGGGAGTGGCAGGAAGAGGG - Intronic
1133153754 16:3857096-3857118 CTCTGAGAGTGGCAGGATGATGG - Intronic
1133809831 16:9152833-9152855 CCCTGGGAGGGGTGAGCAGAGGG - Intergenic
1135734956 16:24923483-24923505 GGCTGGGCGTGGTGGGATGATGG + Intronic
1136308051 16:29386045-29386067 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136321467 16:29487589-29487611 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136436147 16:30227559-30227581 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136445119 16:30312489-30312511 CACTGGTAGTGGTGGGAGAAGGG - Intergenic
1136504965 16:30697369-30697391 TTCTGGGGGTGATGGGAGGAGGG + Intergenic
1136775510 16:32869740-32869762 CTCTGGGAGGGGCTGGAAGCAGG - Intergenic
1136895107 16:33991772-33991794 CTCTGGGAGGGGCTGGAAGCAGG + Intergenic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138033177 16:53577454-53577476 CACTAGGAGTGGTGGTAAAAGGG + Intergenic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1139471273 16:67179357-67179379 AGCTGGGAGGGGTGGGAAGGAGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139551192 16:67673993-67674015 CTCTGGCAGAGCTGGGTAGAAGG + Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140782378 16:78308341-78308363 TTCAGGCAGTGATGGGAAGAGGG + Intronic
1141589063 16:85055740-85055762 CTGGGGGAGAGGTGAGAAGAAGG - Intronic
1142327149 16:89423133-89423155 CTCTGAGGGTGTTGGGAAGGTGG - Intronic
1142397343 16:89839734-89839756 CTCTGGGGGTGGGGTGAAAAGGG + Intronic
1203077928 16_KI270728v1_random:1131849-1131871 CTCTGGGAGGGGCTGGAAGCAGG - Intergenic
1142623371 17:1178792-1178814 CTCAGGGAAGGGTGGGGAGAAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144951833 17:18998543-18998565 CTCTTGGGGTTGTGGGAAGGAGG + Intronic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1147159712 17:38562919-38562941 CCCTGGGAGAGGCGGGGAGACGG + Exonic
1147167683 17:38602138-38602160 TTCTGGGGGAGGTGGGCAGAGGG - Intronic
1147443133 17:40459656-40459678 CTCTGGGAGATGTGGGAGGGAGG + Intergenic
1147612361 17:41809557-41809579 GTCTAGGGGTGGTGGGAATATGG - Intronic
1147896337 17:43754203-43754225 GTCCGTGAGTGGTGGGCAGAAGG + Exonic
1147953735 17:44121217-44121239 GCCTGGTAGTGCTGGGAAGAGGG - Intronic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148443716 17:47725471-47725493 AGCTGGGAGTGGGGGCAAGAAGG - Intergenic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148763627 17:50022778-50022800 CTCTGGGAATGGGGGGTTGAGGG - Intergenic
1149044736 17:52231528-52231550 CTCAGGGAGGGATGGGGAGAAGG + Intergenic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149328301 17:55555735-55555757 CTCTGAAGATGGTGGGAAGATGG - Intergenic
1149526362 17:57359092-57359114 CTCCGGGAGTGGCGGGAGAAAGG - Intronic
1150259298 17:63774998-63775020 CTATAGGAGTGGGGGCAAGAGGG - Intronic
1150505216 17:65691844-65691866 CTCTGACAGTGGTGTGAGGATGG - Intronic
1150629954 17:66872947-66872969 CTCAAAGAGTGTTGGGAAGAAGG - Intronic
1151887168 17:76929953-76929975 TTCAGAGAGTGGTGGGAACAGGG + Intronic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1151975990 17:77483745-77483767 CTCTGGGAATGGTGCGCAGGAGG + Intronic
1152146493 17:78571856-78571878 GTTTGGGATTGGTGGGCAGAAGG - Intronic
1152718054 17:81909283-81909305 CGCTGGCAGTGGTGGGGAGCAGG + Intronic
1152823899 17:82451650-82451672 CTCAGGCAGTGATGGGAAGGGGG + Intergenic
1152936078 17:83137572-83137594 CTCTCGGAGTGGGGGAAGGAAGG + Intergenic
1153522010 18:5962441-5962463 GACAGGGAGTGGCGGGAAGAGGG + Intronic
1153800498 18:8663755-8663777 CACTGTGAGTGATCGGAAGAGGG + Intergenic
1154010339 18:10568744-10568766 CTCTGGGAGCTGAGAGAAGAGGG - Intergenic
1154027976 18:10725511-10725533 AGCTGGGAGTCGTGGGAAGGAGG + Intronic
1154158773 18:11964630-11964652 CTCTGGGAGTGGTGGTAGTAGGG - Intergenic
1155380607 18:25218221-25218243 TTCTGGCAGTGGTGTGGAGATGG + Intronic
1155996301 18:32334444-32334466 CACAGGGAGTGGGGGGAGGATGG + Intronic
1156144309 18:34157841-34157863 CTTTGGGAGAGGTAGGAACAGGG + Intronic
1157249858 18:46085387-46085409 CACTTTGAGAGGTGGGAAGATGG + Intronic
1157395775 18:47339744-47339766 TGCTGGGAGATGTGGGAAGATGG + Intergenic
1157749385 18:50164739-50164761 CTGTTGGAGGGGTGGCAAGAGGG - Intronic
1158657524 18:59352640-59352662 TCCTGGGAGTTGGGGGAAGAGGG - Intronic
1158904743 18:62001150-62001172 CTAGTGGAGTGGTGGGAAGGAGG - Intergenic
1159087811 18:63813897-63813919 TTCTGGGGGTAGTGGGGAGAAGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160009847 18:75098185-75098207 CGCTGGGAGTGGTGGGATGGGGG + Intergenic
1160214411 18:76915245-76915267 CTATGGGAGTGATGAAAAGATGG + Intronic
1160226031 18:77011585-77011607 CTCTGGGAGTGGCAGGCAGCCGG - Intronic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160866985 19:1260424-1260446 CGCTGGGCGGGGTGGGAAGGAGG + Intronic
1160870013 19:1273399-1273421 TTCTGGCAGTGGTGGCCAGAGGG + Intronic
1160875515 19:1294689-1294711 CTCTGGGGGTGCTGAGAGGAGGG + Intronic
1160993156 19:1869217-1869239 CTCTGGAAGTGCTGGGATTACGG - Intergenic
1161184880 19:2910849-2910871 CTCCGGAAGTGCTGGGATGACGG + Intronic
1161232339 19:3180509-3180531 CTCTGGGCGTTGCGGGAAGTGGG + Intergenic
1161445607 19:4317323-4317345 CTCTGGGGGCTGTGGGAGGAAGG - Intronic
1162124914 19:8494258-8494280 TTCTGGGAGTGGTTGGAGGCAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163765794 19:19162638-19162660 CCCAGGGAGAGGTGGGAAGGAGG - Intronic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164564086 19:29313645-29313667 CTCAGGGGGTGGTGGGAGGTTGG - Intergenic
1164749757 19:30644144-30644166 CCCTGGGAGATGTTGGAAGAGGG + Intronic
1164771092 19:30809589-30809611 CACTGGGAGTGATTGGAAGGGGG - Intergenic
1165104389 19:33460489-33460511 CTCTGAAGATGGTGGGAAGATGG - Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166260950 19:41640505-41640527 CTCTGGGAGTGGGTGGGAGGAGG - Intronic
1166541120 19:43606721-43606743 CTCTGTAAGTGCTGGGAAAATGG + Intronic
1167506255 19:49872682-49872704 TGCTGGGAGTGGTGGGCACAAGG - Intronic
1167715164 19:51138302-51138324 TCCTGGGAGTGGGGAGAAGAGGG - Intergenic
1167776305 19:51559909-51559931 CTCTGGACATGGTGAGAAGATGG - Intergenic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
925066811 2:934106-934128 CTCAGGAAGTGCTGGGAATATGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
926316535 2:11714489-11714511 CTCTGGGAGTGGGGCGAGGGAGG - Intronic
927471464 2:23380761-23380783 GGCTGGGGGTGGTGGGAGGAGGG + Intergenic
927857376 2:26535989-26536011 CCCTGGGAGTCTTGGGAGGAGGG + Intronic
928502453 2:31911362-31911384 CTCAGGGAGAGGGGAGAAGAAGG + Intronic
928606461 2:32947964-32947986 CTCTGGGCGCCGCGGGAAGAGGG + Intronic
929541684 2:42827951-42827973 CGCGGGGAGAGGTGCGAAGAAGG + Intergenic
929610731 2:43268950-43268972 CTCTGTCAGGGGTGGCAAGATGG - Intronic
929673126 2:43895236-43895258 CTCTTGGTGAGATGGGAAGAGGG - Intronic
929761897 2:44814047-44814069 GTCAGGGAGTGGTGGAAAGAAGG + Intergenic
929779036 2:44946058-44946080 CTCTGGGAGTGATAAGAAAATGG - Exonic
929892468 2:45929712-45929734 TCCTGGGGGTGGGGGGAAGATGG - Intronic
931257686 2:60587721-60587743 CTCTGTGGGTTGTGGGTAGATGG + Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932708897 2:74047773-74047795 CTGTCGGACAGGTGGGAAGAGGG - Exonic
933420961 2:82044144-82044166 CTCTAGGCATTGTGGGAAGAGGG - Intergenic
933837788 2:86259842-86259864 CTAGGGGAGAAGTGGGAAGAGGG + Intronic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935650262 2:105375821-105375843 CACTGGGAGTTGGGGGCAGAGGG + Intronic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
937258756 2:120572344-120572366 CTCTGGGAGCTGTGGGGAGCTGG + Intergenic
937363078 2:121242535-121242557 CCCTGGGTGAGGTGGGAAGCAGG - Intronic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937392706 2:121504787-121504809 ATCTGGGCTTGGTGGAAAGATGG - Intronic
937465128 2:122125594-122125616 ATCTGGGATTGCTGGCAAGATGG - Intergenic
937726765 2:125175976-125175998 CTAGGGGAGCTGTGGGAAGAGGG + Intergenic
937800643 2:126077127-126077149 CTAGTGGAGTGGTGAGAAGAGGG + Intergenic
937983305 2:127627371-127627393 CTCGGGGAGAGATGGGGAGAGGG + Intronic
938102045 2:128504078-128504100 CTCTGAGGGTGGTTGGGAGATGG + Intergenic
939115472 2:138055794-138055816 ATATGGGAGTGGTGGGATGGTGG - Intergenic
939895558 2:147786964-147786986 CCCTGGCAGTGGTAGGAAGGTGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941070483 2:160949073-160949095 CGCTGGGAGTGGTGATGAGAAGG - Intergenic
941509478 2:166387726-166387748 CTCTGATAATGCTGGGAAGAAGG + Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
946433916 2:219639861-219639883 CTAGGGGAGTGCTGGGAAGCAGG - Intronic
946834957 2:223763513-223763535 CTCTGGGAGTTGGGGGCAGGTGG - Intronic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948155147 2:235775610-235775632 CTCGGGGCGGGGTGGGAGGAAGG - Intronic
948248387 2:236505560-236505582 GCCTGGGAGTGTTGGGAGGAGGG - Intronic
948362578 2:237433360-237433382 CTCTGGGAGGGGTGGCGAGTGGG + Intergenic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948732979 2:239979061-239979083 CTCAGGGAGTGGTGTGACGCTGG - Intronic
948790075 2:240372455-240372477 ATGTGGGAGGGATGGGAAGAGGG + Intergenic
1168795012 20:605542-605564 CTCAGGGAGTGGTAGGGAAAAGG + Intronic
1168973906 20:1949881-1949903 CTCAGAGAGTGGTGGGGAGAAGG - Intergenic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1169533405 20:6509780-6509802 TTTTGGGGGTGATGGGAAGAGGG + Intergenic
1169641523 20:7757562-7757584 CTATGTGAGAGGTGGGTAGAAGG - Intergenic
1169689999 20:8319842-8319864 CTCTTGGGGTGGGGGGAAGGGGG + Intronic
1169766450 20:9152725-9152747 CTAGTGGAGTTGTGGGAAGAAGG + Intronic
1170696019 20:18659749-18659771 GTCAGGGAGTGGGGGGAAAAGGG + Intronic
1171178676 20:23075098-23075120 CGCTGGGAGTGCTGGAGAGAAGG + Intergenic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172589184 20:36105619-36105641 GCCAGGGAGTGATGGGAAGAAGG + Intronic
1172758849 20:37307965-37307987 CTCCGGAAGTGGTGGGAACTGGG + Intronic
1172790146 20:37498209-37498231 CTCTGGGAGTGATTGGGAAATGG - Intronic
1173476549 20:43363909-43363931 CTCCGGGTGAGATGGGAAGAAGG - Intergenic
1173596528 20:44262172-44262194 CTCTGGTAGGGGTGGGGAGAAGG + Intronic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1174278279 20:49419607-49419629 CTCTGGGGGTGGTGAGAGGTGGG - Intronic
1174672858 20:52324144-52324166 CTGTGGGAGGGATGTGAAGACGG + Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175661145 20:60813441-60813463 AACTGGAAGTGATGGGAAGACGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1176546477 21:8203983-8204005 CTCTCGAAGTGCTGGGATGACGG + Intergenic
1176554371 21:8248174-8248196 CTCTCGAAGTGCTGGGATGACGG + Intergenic
1176565428 21:8387030-8387052 CTCTCGAAGTGCTGGGATGACGG + Intergenic
1176573293 21:8431198-8431220 CTCTCGAAGTGCTGGGATGACGG + Intergenic
1176924200 21:14727107-14727129 CTCTGGGGGTTGTGGGGAGTGGG - Intergenic
1178504731 21:33153287-33153309 GTCTGTGAGTGCTGGGAATATGG + Intergenic
1178589726 21:33899094-33899116 CTCTGGCTGGGGTGGCAAGAGGG + Exonic
1179140709 21:38722622-38722644 CCCTGGAGGTGGTGGGAACATGG + Intergenic
1179176069 21:39009230-39009252 CTCTTGGAGGGCTGGGATGATGG - Intergenic
1179250468 21:39667482-39667504 CTCTGGGAATGGTAAGAACAAGG + Exonic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180796546 22:18608606-18608628 CCCAGGGAGTGGTGGACAGAGGG - Exonic
1181037713 22:20177970-20177992 CACTGGGACTGGTGGGAAACTGG + Intergenic
1181235080 22:21443751-21443773 CTCTGGTAGGGGTGAGAGGATGG + Intronic
1181751099 22:24989732-24989754 CTTGGGGAGTGGTGGGGAAAGGG - Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1181858249 22:25798168-25798190 CTCTCGGAGCGGTGGGAACAGGG + Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182081412 22:27531698-27531720 AGCTGGGAGTGGAGGGAAAAGGG + Intergenic
1183586229 22:38754826-38754848 CTCTGGGAGTTCTGGGAGGGCGG - Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG + Intronic
1185179269 22:49349899-49349921 CTCTGGGAGTGGTGGCTGGCAGG - Intergenic
1185337856 22:50278744-50278766 ATATGGGAGTGGTGGGCAGTGGG - Intronic
1203251340 22_KI270733v1_random:120245-120267 CTCTCGAAGTGCTGGGATGACGG + Intergenic
1203259385 22_KI270733v1_random:165319-165341 CTCTCGAAGTGCTGGGATGACGG + Intergenic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
949538467 3:5013673-5013695 AGCTGAGAGTGGGGGGAAGAAGG - Intergenic
949775328 3:7626185-7626207 TTCTGGGAGGGGAGGGACGAGGG - Intronic
950063615 3:10093044-10093066 AACTGGGAGTGTTGAGAAGATGG - Intronic
950654877 3:14430405-14430427 CTCTGGGGGTGCTGGGGACATGG - Intronic
950889105 3:16387355-16387377 CTCTGGAGGTGGTGGGAAAGTGG - Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
952222072 3:31332836-31332858 AACTAGGAGTGGTGGCAAGATGG + Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
952959616 3:38581114-38581136 CTCTGGGGGTGGCGGGGAGTAGG + Exonic
953320009 3:41962928-41962950 CTCAGGCAATGATGGGAAGATGG + Intergenic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
955365770 3:58308644-58308666 ATCTGGGAGTGGTTGGAACTGGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959892028 3:111567758-111567780 TTATGCCAGTGGTGGGAAGAGGG + Intronic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
960583938 3:119303571-119303593 CTCCAGTAGTGGTGGGAAGGGGG - Intronic
960982470 3:123243238-123243260 TTCTGGGAGGGGTGGGGAGGGGG + Intronic
961069781 3:123911944-123911966 CTCCAGGGGTGGTGGGAATAAGG + Intronic
961407616 3:126692840-126692862 GTCTGAGGGTGGTGGGAACAAGG + Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961616160 3:128182853-128182875 CTCTGTGGCTGGTGGGAAGCAGG - Intronic
962494172 3:135922955-135922977 CTCCTGGAGAGATGGGAAGAAGG + Intergenic
962715665 3:138124161-138124183 CTCTTGGCGGGGTGGGCAGAGGG - Exonic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
968434942 4:579564-579586 CTCAGGAAGTGATGGGAAAAGGG - Intergenic
968669902 4:1843654-1843676 GCCTGGGAGGGGTGGGAAGGGGG + Intronic
968793843 4:2688677-2688699 CTCTGGCTGTAGTGGGGAGAAGG + Intronic
969044585 4:4327685-4327707 CCCTGGGAGTTCAGGGAAGAGGG - Intergenic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
969375513 4:6760967-6760989 GTCTGGGAGGGGTAGGAAGTGGG - Intergenic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971418590 4:26455587-26455609 GTCTGGGAGTGATGGGGAGAGGG + Intergenic
971753353 4:30678538-30678560 CTAGTGGAGTGGTGAGAAGAGGG + Intergenic
972346876 4:38199742-38199764 CTCTGCGTGTGGTGGGAACGGGG - Intergenic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
973954604 4:56049716-56049738 CTCCGGGGGCGGTGGGGAGAGGG - Intergenic
975535952 4:75450583-75450605 TTCTCGGGGTGGGGGGAAGAAGG - Intergenic
976117841 4:81746976-81746998 CTCTGAGAGTGGTGTGCAGGAGG + Intronic
977357726 4:95968372-95968394 CTTTGGGAGAGGTGGGAAAGGGG - Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979764369 4:124446624-124446646 CTAGTGGAGTTGTGGGAAGAGGG - Intergenic
979962418 4:127036691-127036713 GTCTGGGAGTGGAGCAAAGAGGG - Intergenic
980242190 4:130191269-130191291 CTACTGGAGTGGTGAGAAGAGGG - Intergenic
980709340 4:136543862-136543884 TTCTGAGAGAGGAGGGAAGACGG + Intergenic
981045485 4:140261319-140261341 CTGTTGGAGTGGTGGGGTGATGG - Intronic
981106515 4:140887766-140887788 CTCTGGGAGGGGTGGGGAAGAGG + Intronic
981546870 4:145902765-145902787 TGCTGGGCGTGGTGGGAAGGCGG + Exonic
981609686 4:146579959-146579981 CTCTGAGGGAGGTGAGAAGAGGG + Intergenic
981812353 4:148790082-148790104 CTCTGGGGGTGGTGAGAATCGGG - Intergenic
982274114 4:153622247-153622269 CCCTGGGAGTGGTAGGCAGAGGG + Intronic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
983442832 4:167809503-167809525 CTCTGGAGGTGGTGGGTGGAAGG - Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986451549 5:7869700-7869722 CGCTGAGAGTCGTGGGAAGGTGG + Intronic
987527338 5:19069824-19069846 CTCTGTGTGTGGTAGGATGAAGG + Intergenic
988396032 5:30698815-30698837 CTCGTGGAGTTGTGAGAAGAGGG + Intergenic
988832239 5:34999174-34999196 TTCTGGGAGTTGTGGCAATAAGG - Intronic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989651338 5:43694318-43694340 GACTAGGAGTGGTGAGAAGAGGG + Intronic
991659704 5:68938015-68938037 GTCGGGGTGGGGTGGGAAGAGGG - Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992563326 5:77973403-77973425 CTCTGGGAGTGGCGGCGACAGGG + Intergenic
992896940 5:81253730-81253752 CTTTGGGAGCTGTGGGAAGTGGG - Intronic
993689580 5:90982826-90982848 CTCTGCATGTGGTGGGAGGAGGG + Intronic
994267130 5:97730981-97731003 CTTTGAGAGTGGTAGGATGATGG + Intergenic
994548768 5:101205197-101205219 CTATTGGAGCTGTGGGAAGAGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995319994 5:110823713-110823735 GTCTGCCAGTGGAGGGAAGATGG - Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996312625 5:122123796-122123818 CTCTGAGACTGGTGGAAAGAAGG + Intergenic
996507687 5:124286675-124286697 CTCTGGAATAGGTGGCAAGAAGG + Intergenic
996789508 5:127277627-127277649 CACTGGGAGTGGTTGGTGGAGGG + Intergenic
996815201 5:127566605-127566627 CTCTGGGGGAGGTGGCAGGAAGG - Intergenic
996950608 5:129120824-129120846 CACATGTAGTGGTGGGAAGAAGG - Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997254806 5:132420294-132420316 CCCTGGGAGTGACTGGAAGAAGG - Intronic
997836465 5:137197314-137197336 CTCTGGGAGATGAGGGATGAGGG + Intronic
998371077 5:141661896-141661918 CTCAGGGGGAGGTGGGAAGGGGG - Intronic
999768323 5:154756562-154756584 CGCCGGGCGGGGTGGGAAGAGGG - Intronic
1000771585 5:165361638-165361660 CTTTGGGAGTGGGGTGAAGGTGG - Intergenic
1000900336 5:166904674-166904696 ACCGGGGAGTGGTGGGGAGAGGG + Intergenic
1001375405 5:171251779-171251801 CTCTGTGATTGGGTGGAAGATGG + Intronic
1001711785 5:173784643-173784665 CTCTGGGACAGTGGGGAAGATGG - Intergenic
1002373084 5:178769990-178770012 TTCTTGGGGTGGTGGGAGGAGGG + Intergenic
1002509249 5:179702293-179702315 CTCTGGGAGTTGGAGGAAGCAGG - Intronic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003176026 6:3752366-3752388 CCCTCGGAGAAGTGGGAAGAGGG + Intergenic
1003373227 6:5549326-5549348 GTCGTGGAGTGGGGGGAAGAGGG - Intronic
1004159101 6:13197780-13197802 CTCTGGGAGGGCTGGGAAGGAGG - Intronic
1004180819 6:13379117-13379139 CCCAGGGAGTGGTGGGAAGATGG + Intronic
1004871866 6:19913208-19913230 ATCTGGAAGAAGTGGGAAGAGGG + Intergenic
1005643897 6:27823556-27823578 CTCTTTGTGTGATGGGAAGATGG + Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005843944 6:29763058-29763080 CTCTGGAGGGGGTGGGGAGAGGG + Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006147340 6:31967540-31967562 TTCTTGGGGTGGTGGGAGGAAGG - Intronic
1006303497 6:33206352-33206374 CTATGAGAATGGTGGGGAGAGGG - Intronic
1006411001 6:33873139-33873161 CTTTGGGAGATGTGGGAGGATGG - Intergenic
1006415616 6:33902056-33902078 CTCTGGGAATTGGGGGAAAAGGG + Intergenic
1006441203 6:34054725-34054747 GACTGGAAGTGGTGGCAAGATGG - Intronic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1007693872 6:43719524-43719546 CCCTGGGAATGGTGGGGAGATGG + Intergenic
1009334475 6:62469457-62469479 TTCTGGGAGTGTTGGCAATAGGG + Intergenic
1010807049 6:80249650-80249672 CTCTTGGGGTGGAGGTAAGAGGG + Intronic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1011548053 6:88502132-88502154 CACACGGAGTGGTGGGTAGATGG + Intergenic
1012575288 6:100788848-100788870 AACTGGGAGTGGTGGGAAAGAGG + Intronic
1013084255 6:106842050-106842072 CTCTGCAAGTGTGGGGAAGAGGG - Intergenic
1013289665 6:108709133-108709155 CCCTGGGAATGGTGGGGAGCAGG + Intergenic
1013318505 6:108963988-108964010 CTCTGGGAGTGGTGGGTATTGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1015487402 6:133788497-133788519 GGCTAGGAGTGGTGGAAAGAGGG - Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019496404 7:1342405-1342427 CCCTGGGAGTGGTGTGAATCGGG + Intergenic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1020710711 7:11600905-11600927 ATCTGAGAGTGGTGGTAAAAGGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023562712 7:41492474-41492496 CACAGGGAGTGGTGGGAAGGAGG + Intergenic
1023669397 7:42560325-42560347 CTAGTGGAGTGGTGAGAAGAGGG + Intergenic
1024383496 7:48725300-48725322 CTAGTGGAGTGGTGAGAAGAGGG - Intergenic
1024462957 7:49678987-49679009 CTCTGAGAATGGTGTCAAGATGG + Intergenic
1024548590 7:50541958-50541980 CTTGGGGAGTGGTGGAGAGAGGG + Intronic
1024829638 7:53435103-53435125 GTCTGGGAGAGATGGGAATATGG - Intergenic
1026889799 7:73975130-73975152 GTCTGGAACTGGTGGGGAGAAGG - Intergenic
1028430194 7:90737392-90737414 ATCTGGGAGATGTGGGAGGAGGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028627293 7:92891424-92891446 GGCTGGGAGTTGTGGGAGGATGG + Intergenic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1031447620 7:121873588-121873610 CTCCGGGATCGGTGGGATGAGGG + Intronic
1031526911 7:122833507-122833529 AGCTGGGTGTGGTGGGAGGACGG - Intronic
1031553877 7:123147877-123147899 CTTTGGGAGTAGTGGTGAGAAGG - Intronic
1032513383 7:132489730-132489752 CGCTGGGAGGGGTTGGATGAGGG - Intronic
1032676027 7:134130281-134130303 CTCTGGGGGGGGGGGGAAGCTGG - Intronic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033374179 7:140741518-140741540 CACAGCTAGTGGTGGGAAGAAGG - Intronic
1033587762 7:142787079-142787101 CTCTAGGAGGGGTGCGATGAGGG + Intergenic
1033651295 7:143345862-143345884 CCCTGAAAGTAGTGGGAAGAGGG + Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034313817 7:150111873-150111895 CGCCGGGAGTGGTGGGAAGGGGG - Intergenic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034489760 7:151386969-151386991 CCCTGGGGGCGGTGCGAAGAAGG - Intronic
1034793081 7:153988919-153988941 CGCCGGGAGTGGTGGGAAGGGGG + Intronic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035122475 7:156579748-156579770 GTCTGTGAGTGGTGGGGGGAGGG + Intergenic
1035280102 7:157773015-157773037 TTCTGGGAGTTCTGGGAAGCTGG - Intronic
1035399894 7:158557870-158557892 TGCTGGGAATGCTGGGAAGAGGG - Intronic
1035722456 8:1802359-1802381 CTCTGGAAGTGATAGGAACAAGG + Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037740937 8:21608804-21608826 CACTGGGAATGGTGCTAAGAAGG - Intergenic
1037916018 8:22773890-22773912 CGATGGGAGAGTTGGGAAGAAGG + Intronic
1037926908 8:22850814-22850836 CTCAGGGAGGGGTAGGAGGAAGG + Intronic
1038372350 8:27006825-27006847 GTCTGGGAGGGGTGGGGAGGAGG + Intergenic
1038398485 8:27265036-27265058 AGCTAGGAGTGGTGGAAAGAAGG + Intergenic
1038724643 8:30069695-30069717 CTCTGGTAACGGTGGGAAAATGG + Exonic
1039415105 8:37386666-37386688 CTTTGGGAAAGGTGGGAAGCTGG - Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1041944264 8:63424180-63424202 CACTGGGACTGGTTGGAAGGTGG + Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042874761 8:73431042-73431064 CTTGGGGAGTTGTGGGAAGAAGG + Intronic
1043261783 8:78209504-78209526 CACTGGGTGTGGTAGGGAGAGGG + Intergenic
1043326605 8:79060114-79060136 CTCCAGGAGTGGTGTGTAGATGG + Intergenic
1043486642 8:80704592-80704614 CTCTGGGGGTGGTGGGGGAAAGG + Intronic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1045501499 8:102747564-102747586 CCCTGGGAGTGCTGGGTGGAGGG - Intergenic
1046854804 8:119019055-119019077 CTCTGGGAGTTGTTGGATGCGGG - Intronic
1047175466 8:122536519-122536541 CTCTGGGTGGGGTGGGAGAATGG + Intergenic
1047322632 8:123802327-123802349 ATCTGAGAGAGATGGGAAGAGGG + Intronic
1047806249 8:128363591-128363613 CTCTGGGAGTTGTGGGAATTAGG + Intergenic
1047941260 8:129829697-129829719 CTCGGGGGGTGGTGGGAATGAGG - Intergenic
1048130714 8:131693989-131694011 CTCATGGAGCTGTGGGAAGAGGG - Intergenic
1048463539 8:134642720-134642742 CTGTGCGAGTGCTGGGAAGCTGG - Intronic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049480091 8:142818483-142818505 TGCTGGGAGTGGTACGAAGAGGG - Intergenic
1049912554 9:283550-283572 GGCTTGGAGAGGTGGGAAGATGG - Intronic
1050701547 9:8345360-8345382 CACTGGGGGTGCTGGGAACAGGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051579532 9:18656089-18656111 GTCTGAGAGGGGTGGAAAGAAGG - Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1052009281 9:23386796-23386818 TTCTGGCAATGGTGGGCAGATGG - Intergenic
1052290779 9:26837600-26837622 GTCGGGGAGTGGCGGGAAGAGGG + Intergenic
1053334141 9:37249092-37249114 ATGTGGGAGAGGTGGGGAGATGG + Intronic
1056255513 9:84795340-84795362 CCCTGGGCGTGTTGGGATGAGGG - Intronic
1056321624 9:85440575-85440597 CTCTGGAAGCTGTGGCAAGAGGG + Intergenic
1056780933 9:89550413-89550435 TTCTGGGATTGGGAGGAAGACGG - Intergenic
1056844512 9:90025574-90025596 TTCTGGGAGGAGTGGGAGGAAGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057340245 9:94194454-94194476 CTCTGAAAGTGGTGGGATTACGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1059733052 9:117075466-117075488 GTCTGGCAGTGGTGGGCAGATGG + Intronic
1060104785 9:120866821-120866843 CCTTGGGCGTGGTGGGGAGAGGG - Intronic
1060280590 9:122213441-122213463 ATCTAGGAGTTGGGGGAAGAAGG - Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1060880014 9:127111506-127111528 AGCTGGGAGTGCTGGAAAGAGGG + Intronic
1061121214 9:128643707-128643729 CTCTGGGAATCGTGGAAAGAAGG + Intronic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061370727 9:130196001-130196023 CTCTGGGAGGAGGGGGAAAATGG + Intronic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1061627009 9:131846678-131846700 TTAGGGGAGTGGTGGGAGGAGGG - Intergenic
1062175186 9:135158004-135158026 CTCAGGGAGAGGTGGTGAGATGG + Intergenic
1203467742 Un_GL000220v1:103396-103418 CTCTCGAAGTGCTGGGATGACGG + Intergenic
1203475567 Un_GL000220v1:147372-147394 CTCTCGAAGTGCTGGGATGACGG + Intergenic
1187639623 X:21273995-21274017 CTCAGGGAGCTGTGAGAAGAAGG - Intergenic
1187974362 X:24690607-24690629 CTCTGGGAAAGGTGAGAAGGAGG - Intergenic
1189008334 X:37018323-37018345 CTCTGGGAGGGCTGGAAAGCTGG - Intergenic
1190012419 X:46796675-46796697 ATCTGTGAGTGGTTGGAAGAGGG - Intergenic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1191716177 X:64195210-64195232 CCCTGGGTCTGGTGGGAATAGGG + Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192189560 X:68982662-68982684 CTCTGGAAGTGGTGGCAATGTGG + Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192536277 X:71930548-71930570 ACCAGGGACTGGTGGGAAGATGG - Intergenic
1192539431 X:71955692-71955714 CTCTGGGAGCTGTGAGAGGAGGG + Intergenic
1192962453 X:76145121-76145143 CTCCGGGAGTAATGCGAAGATGG - Intergenic
1192963080 X:76149966-76149988 CTCCGGGAGTAATGCGAAGATGG + Intergenic
1193399261 X:81022198-81022220 CCCTGGGCGAGGTGTGAAGATGG - Intergenic
1194504733 X:94719631-94719653 TTGAGGGAGTGCTGGGAAGAGGG - Intergenic
1195898699 X:109774566-109774588 CTTCTAGAGTGGTGGGAAGAGGG + Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1199095944 X:143738663-143738685 CTGTTGGAGGGGTGGCAAGAGGG + Intergenic
1199286103 X:146056042-146056064 ATCTGTGAGTAATGGGAAGAGGG + Intergenic
1199411167 X:147525195-147525217 CTTTGGTGGAGGTGGGAAGAGGG - Intergenic
1201584823 Y:15548863-15548885 CTTTGGCTGTGTTGGGAAGAGGG + Intergenic
1201795203 Y:17889669-17889691 CACTGGGAGTGCTGGGAAGTGGG + Intergenic
1201806352 Y:18016315-18016337 CACTGGGAGTGCTGGGAAGTGGG - Intergenic