ID: 1166259389

View in Genome Browser
Species Human (GRCh38)
Location 19:41627224-41627246
Sequence CAACCCTGCTTCTCAAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 2, 2: 13, 3: 94, 4: 697}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166259389_1166259393 3 Left 1166259389 19:41627224-41627246 CCACACTTTGAGAAGCAGGGTTG 0: 1
1: 2
2: 13
3: 94
4: 697
Right 1166259393 19:41627250-41627272 GAGTCCCCTGTCCCCAGAGAGGG 0: 1
1: 0
2: 0
3: 35
4: 383
1166259389_1166259392 2 Left 1166259389 19:41627224-41627246 CCACACTTTGAGAAGCAGGGTTG 0: 1
1: 2
2: 13
3: 94
4: 697
Right 1166259392 19:41627249-41627271 GGAGTCCCCTGTCCCCAGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166259389 Original CRISPR CAACCCTGCTTCTCAAAGTG TGG (reversed) Intronic