ID: 1166259389

View in Genome Browser
Species Human (GRCh38)
Location 19:41627224-41627246
Sequence CAACCCTGCTTCTCAAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 2, 2: 13, 3: 94, 4: 697}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166259389_1166259393 3 Left 1166259389 19:41627224-41627246 CCACACTTTGAGAAGCAGGGTTG 0: 1
1: 2
2: 13
3: 94
4: 697
Right 1166259393 19:41627250-41627272 GAGTCCCCTGTCCCCAGAGAGGG 0: 1
1: 0
2: 0
3: 35
4: 383
1166259389_1166259392 2 Left 1166259389 19:41627224-41627246 CCACACTTTGAGAAGCAGGGTTG 0: 1
1: 2
2: 13
3: 94
4: 697
Right 1166259392 19:41627249-41627271 GGAGTCCCCTGTCCCCAGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166259389 Original CRISPR CAACCCTGCTTCTCAAAGTG TGG (reversed) Intronic
900279160 1:1854782-1854804 CACCTCGGCTTCCCAAAGTGCGG - Intronic
900861402 1:5235200-5235222 GAATCTTGCTGCTCAAAGTGTGG + Intergenic
901682022 1:10918687-10918709 GAGCCTCGCTTCTCAAAGTGTGG - Intergenic
901926847 1:12571453-12571475 GAACAGTGGTTCTCAAAGTGAGG + Intronic
902563234 1:17291782-17291804 CAATAGTGATTCTCAAAGTGTGG + Intergenic
902599150 1:17529432-17529454 CAAGCCAGCTTCTCAGGGTGGGG + Intergenic
903704724 1:25277317-25277339 GATCCATGTTTCTCAAAGTGTGG + Intronic
903722509 1:25416007-25416029 GATCCATGTTTCTCAAAGTGTGG - Intronic
904095342 1:27972633-27972655 CAATCCTGCATCTCAATCTGAGG + Exonic
904464945 1:30702091-30702113 CAAACCTGCTTCTCTATATGAGG + Intergenic
904800782 1:33091859-33091881 CAGCCCTGCTTATCAAAGAATGG + Intronic
904903080 1:33872982-33873004 AAACACTGCTACTCAAAGGGAGG - Intronic
905784558 1:40743897-40743919 CGGCCCTGCTACTCAAAGTAAGG - Intronic
905844286 1:41214750-41214772 TAACCCTGATTCTCCAATTGAGG + Intronic
906257829 1:44364218-44364240 AAACCTTGCTACTCAAGGTGTGG - Intergenic
906478025 1:46183061-46183083 CACCTCTGCCTCCCAAAGTGCGG + Intronic
906481488 1:46202317-46202339 TAACCTTGTTACTCAAAGTGTGG + Intronic
906931141 1:50170721-50170743 AAACCTTGCTACTCAAGGTGTGG - Intronic
907098917 1:51809543-51809565 GAATCGTGCTACTCAAAGTGTGG + Intronic
907198364 1:52705445-52705467 AATCCTTGCTACTCAAAGTGTGG + Intergenic
907344541 1:53764042-53764064 GAACACTGGTTCTCAAAGTATGG + Intergenic
907441291 1:54480241-54480263 CAACCCAGCTTGTCAAACTGAGG - Intergenic
907551661 1:55310116-55310138 CTCCCTTGCTTCTCAAAGGGTGG - Intergenic
907711502 1:56886859-56886881 GAACGGTGGTTCTCAAAGTGTGG + Intronic
907827394 1:58032055-58032077 AAACTCTGCTTCTCAAAGTGTGG + Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909609005 1:77533622-77533644 CCACACTGATTCCCAAAGTGTGG - Intronic
910135122 1:83958921-83958943 GAGCCTTGCTACTCAAAGTGTGG - Intronic
910674195 1:89800563-89800585 CAGCCTTGCTGCTCAAAGGGTGG + Intronic
911650786 1:100385916-100385938 CACCCCGACCTCTCAAAGTGCGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912120589 1:106467407-106467429 CAACCCTGTTTCTGACAGTGGGG - Intergenic
912348229 1:108986013-108986035 CACCCCTGTTTCTCAAACTAGGG + Intronic
912411207 1:109481844-109481866 CATCACTGCTTTGCAAAGTGGGG + Exonic
913164600 1:116173279-116173301 GAGCATTGCTTCTCAAAGTGTGG - Intergenic
913164606 1:116173395-116173417 AACCCCTGCTACTCAAAGTGAGG + Intergenic
913171582 1:116237559-116237581 TACCCTTGTTTCTCAAAGTGTGG + Intergenic
913177549 1:116288753-116288775 GAACACTGGTTCTCAAAGTGTGG + Intergenic
914197447 1:145455021-145455043 CACCTCGGCCTCTCAAAGTGTGG - Intergenic
914476548 1:148028044-148028066 CACCTCAGCCTCTCAAAGTGTGG - Intergenic
915263844 1:154700322-154700344 AACCCTTGCTACTCAAAGTGTGG - Exonic
915638262 1:157201360-157201382 CAGCCTTGCTACTCAGAGTGTGG + Intergenic
915689299 1:157672486-157672508 CAACTCTGCCTCCCAAAGTTCGG + Intergenic
916145679 1:161736935-161736957 GCACCCTGCTACTCAAAGTGTGG - Intergenic
916201625 1:162277024-162277046 GCTCCTTGCTTCTCAAAGTGTGG + Intronic
916452135 1:164930865-164930887 TAACCAGGCTTCTCAAATTGAGG - Intergenic
916579270 1:166093192-166093214 CTCTCCAGCTTCTCAAAGTGGGG + Intronic
916583272 1:166127372-166127394 AAACCCTTCTGCTCAAAGTCTGG - Intronic
916795839 1:168166528-168166550 TGACGCTGTTTCTCAAAGTGTGG - Intergenic
916880015 1:169011656-169011678 CAACAGTAGTTCTCAAAGTGTGG - Intergenic
917218329 1:172701312-172701334 AAACCTTGCTACTCAAAGTGTGG - Intergenic
917482385 1:175423502-175423524 CAACCCTGCTTTCCAGAGTGGGG + Intronic
917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG + Intronic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919799939 1:201347944-201347966 GGACCTTGCTGCTCAAAGTGTGG - Intergenic
919980094 1:202637619-202637641 CAAAGCTGCTGCTCACAGTGGGG - Intronic
920004754 1:202825010-202825032 CATCCTTGCTGCTCGAAGTGTGG - Intronic
920180608 1:204129819-204129841 CAACCCTGTTCCTCAAAGTCTGG - Intergenic
920361116 1:205417147-205417169 CAAACCTGGTTCTCCAAGTTAGG - Intronic
920662180 1:207924572-207924594 TGACCTTGCTGCTCAAAGTGTGG - Intergenic
921215520 1:212933635-212933657 AAAACTTGCTTCTCAAAGTGGGG + Intergenic
922051031 1:221990795-221990817 CATCAGTGGTTCTCAAAGTGTGG - Intergenic
922609166 1:226911622-226911644 CAGCCGTGCTTCTCAAAGTGTGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923336022 1:232970981-232971003 CAGCAGTGCTTCTCAAAGTGCGG - Intronic
923622673 1:235591039-235591061 GAGCCTTGCTACTCAAAGTGTGG - Intronic
923624229 1:235601131-235601153 CATCACTGTTTCTCAAAGTAAGG - Intronic
1063421860 10:5918592-5918614 AAGCCATGGTTCTCAAAGTGTGG + Intronic
1063500885 10:6553209-6553231 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1063533954 10:6864304-6864326 CAGCGGTGCTTCTCAAAGTGTGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1064532699 10:16326193-16326215 CAAGCCTGAGTCTCAGAGTGAGG + Intergenic
1064614278 10:17136315-17136337 GAACCTTGCTACTCCAAGTGTGG + Intergenic
1064787927 10:18918749-18918771 CAGCCTTGCTACTCATAGTGTGG - Intergenic
1064874963 10:19983713-19983735 TAACCTTGCTGCTCAAAGTACGG + Intronic
1064911994 10:20412408-20412430 TAACTGTGCTCCTCAAAGTGTGG - Intergenic
1065514446 10:26511090-26511112 CACCTCGGCCTCTCAAAGTGCGG - Intronic
1066112517 10:32210030-32210052 AAGCAATGCTTCTCAAAGTGTGG + Intergenic
1066296667 10:34059995-34060017 GAACCTCGCTACTCAAAGTGTGG - Intergenic
1066301873 10:34104521-34104543 CTACCCTGCTTCTCAGGGTTTGG + Intergenic
1066317497 10:34262512-34262534 CATCTCTGCTTCCCAAAATGTGG + Intronic
1067190657 10:44065202-44065224 AAACTGTGCTTCTCAAAGTGGGG - Intergenic
1067293667 10:44962044-44962066 CACCCCTGCTTCCCAAGGTCAGG - Intronic
1067723969 10:48752161-48752183 CAGCAATGCTTCTCATAGTGTGG + Intronic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1069292094 10:66792508-66792530 CATCCTTGCTACTCAAACTGTGG - Intronic
1069482379 10:68795538-68795560 CACCTCTGCCTCCCAAAGTGCGG + Intergenic
1069850207 10:71399194-71399216 GAACCTTGCTCCTCAGAGTGTGG + Intronic
1070025693 10:72629429-72629451 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
1070130088 10:73649795-73649817 CACCCCTGCTACTCACAGTCAGG + Intronic
1070258582 10:74831154-74831176 CCACCCTGCTTTTAAAAGTTGGG + Intronic
1070472275 10:76793403-76793425 CATCTCAGCTTCCCAAAGTGTGG + Intergenic
1070528592 10:77316590-77316612 AACCAATGCTTCTCAAAGTGGGG - Intronic
1070724069 10:78776131-78776153 CACCTTTGCTCCTCAAAGTGTGG - Intergenic
1071258335 10:83895482-83895504 CAATCCTGGGTCTCAAGGTGAGG + Intergenic
1071561702 10:86650682-86650704 GGTCCTTGCTTCTCAAAGTGTGG - Intergenic
1071815700 10:89230552-89230574 CACCTCGGCTTCCCAAAGTGCGG + Intronic
1071982846 10:91021282-91021304 AAACCTTGCTACTCAGAGTGTGG + Intergenic
1072177130 10:92937842-92937864 AAGCACTTCTTCTCAAAGTGTGG + Intronic
1072431825 10:95379129-95379151 CACCTCTGCCTCCCAAAGTGTGG - Intronic
1072754325 10:98008483-98008505 CAACTCTGCTTCTCATGGTCTGG - Intronic
1073321010 10:102616291-102616313 TGACTCTGCTGCTCAAAGTGTGG - Intronic
1073417923 10:103400091-103400113 CTACATTGCTTCTCAAACTGGGG + Intronic
1073513774 10:104059547-104059569 AGACCTTGCTACTCAAAGTGTGG - Intronic
1073562567 10:104509448-104509470 CATCAGTGGTTCTCAAAGTGTGG + Intergenic
1073568240 10:104554071-104554093 GAACCTTGCCACTCAAAGTGAGG - Intergenic
1073966149 10:108992768-108992790 CACCTCAGCTTCCCAAAGTGCGG - Intergenic
1074188901 10:111118863-111118885 CCACCCTGCTACTCAAATTATGG + Intergenic
1074863443 10:117531030-117531052 CATTCCTGCCTCTCTAAGTGGGG + Intergenic
1075055270 10:119213771-119213793 CACCCCTGCTTCTCATTTTGAGG + Intronic
1075113869 10:119609632-119609654 CACCTCAGCTTCCCAAAGTGCGG + Intergenic
1075561868 10:123473972-123473994 CACCAGTGGTTCTCAAAGTGTGG + Intergenic
1075887634 10:125915172-125915194 ACGCCATGCTTCTCAAAGTGTGG - Intronic
1076116068 10:127901816-127901838 CACCTCAGCTTCCCAAAGTGTGG - Intergenic
1076215383 10:128688949-128688971 CGAAACTGCTTCTCAAACTGTGG - Intergenic
1076523966 10:131099163-131099185 AAACCCTGCTCCTCAATGGGAGG + Intronic
1077918363 11:6625522-6625544 CCACCCTGCAGCTCAAGGTGGGG - Intronic
1078619068 11:12891279-12891301 CCACCCTGCTTTTTAAAGAGAGG + Intronic
1078925105 11:15867721-15867743 AAACCGTGGTTCTCAAAATGTGG + Intergenic
1079394604 11:20050912-20050934 CAACACGGCTTCTCAGAGAGAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079807076 11:24945470-24945492 CAACCCTTCTTTTGATAGTGTGG - Intronic
1080453948 11:32401786-32401808 CATCTCTGCCTCCCAAAGTGCGG + Intronic
1080757794 11:35218818-35218840 GGACCTTGCTACTCAAAGTGTGG - Intronic
1080934086 11:36843412-36843434 GAACAGTGTTTCTCAAAGTGTGG - Intergenic
1081057468 11:38428447-38428469 CAATTTTGCTTCTCAAAGTAGGG + Intergenic
1081333527 11:41834191-41834213 GAACCATGCTGCTCATAGTGTGG + Intergenic
1081684253 11:45030456-45030478 AAACAGTGGTTCTCAAAGTGAGG + Intergenic
1083302738 11:61747384-61747406 CCTCCCTGCAACTCAAAGTGTGG - Intergenic
1083338658 11:61944486-61944508 GAACCTGGCTTCTCAAACTGAGG - Intergenic
1083710618 11:64546231-64546253 TACCCTTGCTACTCAAAGTGTGG - Intergenic
1084450359 11:69233206-69233228 GAACAGTGCTACTCAAAGTGTGG - Intergenic
1086806196 11:91245984-91246006 CAAACCTGGTTCTCAAATGGAGG + Intergenic
1086906264 11:92421758-92421780 CAACTCTCCGTCTCTAAGTGGGG + Intronic
1087025713 11:93647508-93647530 TAACCTTGCTGCTCAAAATGTGG + Intergenic
1087642660 11:100771988-100772010 AATCCCTGCTTCTCAGAGCGTGG - Intronic
1087673885 11:101136639-101136661 CCACTCAGCTTCCCAAAGTGCGG + Intergenic
1087837758 11:102891843-102891865 GAGCACTGTTTCTCAAAGTGTGG + Intergenic
1087921905 11:103876411-103876433 GAACACTGCTTCTCAAAGTATGG - Intergenic
1087971037 11:104484498-104484520 AAATCCTGCTTCTCAACATGTGG + Intergenic
1088542128 11:110924057-110924079 ATTCCTTGCTTCTCAAAGTGTGG + Intergenic
1089397811 11:118147132-118147154 GCACCGTGGTTCTCAAAGTGTGG - Intronic
1089583587 11:119496428-119496450 CAACAGTGGTTCTCAAAGTGTGG - Intergenic
1089748144 11:120631397-120631419 CATCCTGGCTACTCAAAGTGTGG - Intronic
1089837994 11:121388560-121388582 TATCCCTGCTACTCAAAGTATGG + Intergenic
1089848086 11:121474186-121474208 AAACCTTGCTACCCAAAGTGTGG + Intronic
1090035380 11:123245457-123245479 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
1090256602 11:125288722-125288744 CAGCCTTGCTACTCCAAGTGTGG + Intronic
1090330791 11:125930661-125930683 AAACTTTGCTACTCAAAGTGTGG - Intergenic
1090663944 11:128902469-128902491 CATCCCTGTTCCTTAAAGTGCGG - Exonic
1090750768 11:129744516-129744538 CACCCCGGCCTCCCAAAGTGCGG - Intergenic
1090750795 11:129744650-129744672 CACCCCGGCCTCCCAAAGTGCGG - Intergenic
1091175395 11:133553247-133553269 GAGCCTTGCTTCTCAGAGTGTGG - Intergenic
1091640888 12:2236313-2236335 CAGCACTGCTGCTCAATGTGTGG - Intronic
1091951146 12:4594039-4594061 AATCCTTGCTTCTCAAAGTGTGG - Intronic
1091980073 12:4857622-4857644 CGCCGGTGCTTCTCAAAGTGTGG - Intergenic
1092462785 12:8700467-8700489 TACTCCTGCTTCCCAAAGTGTGG - Exonic
1092760104 12:11802181-11802203 CTTCCCTGCTTCTCCAAGTCTGG + Intronic
1092808945 12:12253893-12253915 CACCTCAGCTTCCCAAAGTGTGG - Intronic
1093622891 12:21313461-21313483 CACCTCGGCCTCTCAAAGTGCGG - Intronic
1093658251 12:21722595-21722617 CAGCCATGGTTCTCAAAGTGTGG - Intronic
1093756623 12:22860055-22860077 GAACAGTGCTTCTCAAAGTGTGG + Intergenic
1094086070 12:26593161-26593183 CTACAGTGATTCTCAAAGTGTGG + Intronic
1094329545 12:29275940-29275962 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1094356347 12:29582315-29582337 CACCCAGACTTCTCAAAGTGAGG - Intronic
1094544629 12:31393077-31393099 CAACCTTGCTTCTCATATTTGGG - Intronic
1094638127 12:32246885-32246907 CAACCCAGCTTCTCAATGAGAGG - Intronic
1096322718 12:50629484-50629506 CAGCATTGGTTCTCAAAGTGTGG - Intronic
1096448232 12:51714605-51714627 TAACACTGGTTCTTAAAGTGTGG - Intronic
1097100185 12:56582525-56582547 CACCAGTGATTCTCAAAGTGTGG + Intronic
1097236851 12:57546490-57546512 CCTGCCTGCTTCTCAAGGTGAGG - Intronic
1097361757 12:58666070-58666092 GGACCATGGTTCTCAAAGTGTGG + Intronic
1097585383 12:61509453-61509475 CCACCAGGCTCCTCAAAGTGTGG - Intergenic
1097644398 12:62218436-62218458 CATCCCTAGTTATCAAAGTGAGG + Intronic
1097674842 12:62589084-62589106 CAACATTGCTTTTCAAAGTATGG + Intronic
1097751042 12:63353254-63353276 CACCCCAGCCTCCCAAAGTGTGG - Intergenic
1098013967 12:66084818-66084840 CACCCAAGCTTCCCAAAGTGTGG - Intergenic
1099125824 12:78756304-78756326 TAACCCTGATTCTCAAACTTTGG - Intergenic
1100032238 12:90207925-90207947 CATCACTGCCTCTCAAAATGAGG + Intergenic
1100211245 12:92400735-92400757 GACCCTTGCTCCTCAAAGTGTGG - Intergenic
1100585402 12:95975139-95975161 TGACCCTGCTACTCAAAGCGTGG + Intronic
1101100231 12:101384290-101384312 CAACTTGGCTTCCCAAAGTGTGG - Intronic
1101232103 12:102752070-102752092 CAGCCTTGCTACTCAAAGTGTGG - Intergenic
1101673961 12:106900799-106900821 GAGCCTTGCTTCTCAAGGTGTGG - Intergenic
1101761797 12:107664772-107664794 CACCTTTGCTACTCAAAGTGAGG - Intergenic
1102324686 12:111969826-111969848 CACCTCAGCCTCTCAAAGTGCGG + Intronic
1102597974 12:114007369-114007391 CACCTTGGCTTCTCAAAGTGTGG + Intergenic
1102753753 12:115320050-115320072 GAACCTTGCTTCTCAAAGTGTGG + Intergenic
1102762727 12:115402795-115402817 GAATCTTGCTCCTCAAAGTGTGG - Intergenic
1102788022 12:115619965-115619987 GAGCCCTGATTCTCAAAATGTGG - Intergenic
1102901070 12:116637503-116637525 CCACCTTGCCTCACAAAGTGCGG + Intergenic
1103054939 12:117811364-117811386 GCACAGTGCTTCTCAAAGTGTGG + Intronic
1103186415 12:118961585-118961607 AAACTTTGCTCCTCAAAGTGTGG + Intergenic
1103596951 12:122029973-122029995 TAAACCTGCCTCTCACAGTGGGG + Intronic
1103691612 12:122779561-122779583 GAGCCTTGCTTCTCAAAATGTGG - Intronic
1104216122 12:126735665-126735687 GAACAGTGATTCTCAAAGTGAGG - Intergenic
1104266975 12:127242855-127242877 CAACACTGGTTCTCCAAGTGGGG - Intergenic
1104348357 12:128023045-128023067 CAACCCTGGCTCTCTATGTGTGG + Intergenic
1104898802 12:132176823-132176845 GACCCCTGATTCTCAAAGTGGGG + Intergenic
1105736956 13:23281495-23281517 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1105982042 13:25527274-25527296 AATCCCTGCTACTCAAAGTGTGG + Intronic
1106017275 13:25881742-25881764 AACCCCTGCTACTCAAAGTGTGG + Intronic
1106140646 13:27008113-27008135 GATCCTTGCTTCCCAAAGTGTGG - Intergenic
1106221527 13:27749751-27749773 CTACCTTGCTTTTCCAAGTGTGG + Intergenic
1106257764 13:28037432-28037454 GACCCTTGCTACTCAAAGTGTGG + Intronic
1106404888 13:29464765-29464787 CAGCAGTGATTCTCAAAGTGTGG + Intronic
1106531929 13:30601440-30601462 CAACCCTCATTTTTAAAGTGAGG - Intronic
1106759887 13:32858102-32858124 AAACCCTGCTGCTCAAATTGTGG - Intergenic
1106851846 13:33802141-33802163 CATCCTTGCTACTCAAAGTGTGG - Intergenic
1107088764 13:36453234-36453256 CAGCCTTGCTGCTCAAAGTGTGG + Intergenic
1107671938 13:42754999-42755021 GAACACTGGTTCGCAAAGTGGGG - Intergenic
1107861725 13:44667183-44667205 GACCCCTGCTACTCAAATTGTGG + Intergenic
1107910985 13:45105619-45105641 GAACCTTGCTATTCAAAGTGTGG - Intergenic
1108394404 13:49978800-49978822 CACCCTTGCTTCTGAAAGTGGGG - Intergenic
1109734441 13:66463652-66463674 CCATCTTGCTCCTCAAAGTGTGG - Intronic
1110144956 13:72179192-72179214 CAGCCTTGTTTCTCAAAGTGCGG + Intergenic
1110792041 13:79597088-79597110 GAACAGTGCTTCTCAAAGTGTGG - Intergenic
1112553990 13:100449736-100449758 CACCTCGGCTTCCCAAAGTGCGG + Intronic
1112877632 13:104064532-104064554 CAGCAATGGTTCTCAAAGTGTGG + Intergenic
1112937891 13:104824031-104824053 TACCCATGCTCCTCAAAGTGGGG + Intergenic
1112970685 13:105258622-105258644 CAGTTCTGCTTCTCCAAGTGGGG + Intergenic
1113523591 13:110956922-110956944 GAGCCTTGCTTCTCAAAGTGAGG - Intergenic
1113619533 13:111703740-111703762 GAGCCTTGCTACTCAAAGTGTGG - Intergenic
1113625062 13:111789001-111789023 GAGCCTTGCTACTCAAAGTGTGG - Intergenic
1113701675 13:112393313-112393335 GAGCCTTGCTTCTCAAAGTGAGG + Intronic
1113779261 13:112966807-112966829 CAGCAGTGTTTCTCAAAGTGTGG + Intronic
1113977954 13:114245471-114245493 AATCCCTGCTGCTCAGAGTGTGG + Intronic
1114192877 14:20453771-20453793 CACCCCAGCCTCCCAAAGTGTGG - Intronic
1114854207 14:26418075-26418097 AAACTTTGCTACTCAAAGTGTGG + Intergenic
1114969952 14:28013700-28013722 CCTCCCTGCTACTCAAAGTAGGG - Intergenic
1115147351 14:30240785-30240807 CAGCCCTGTTTCTCAACGTAGGG + Intergenic
1115199893 14:30841599-30841621 CACCTCAACTTCTCAAAGTGTGG + Intergenic
1115950144 14:38712110-38712132 CTACCTTGCTACTCAAAGTGTGG + Intergenic
1116588652 14:46742602-46742624 GAACAGTGGTTCTCAAAGTGTGG - Intergenic
1116791715 14:49346458-49346480 CACCTCAGCTTCTCAAAGGGCGG - Intergenic
1116797205 14:49404368-49404390 CAGCACTGCTTCTCATATTGGGG + Intergenic
1117235226 14:53767529-53767551 GAACAGTGATTCTCAAAGTGTGG + Intergenic
1117268538 14:54116579-54116601 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1117736017 14:58769371-58769393 CTTCCTTGCTGCTCAAAGTGTGG + Intergenic
1118456813 14:65952142-65952164 CATCTCTGCTCCTCCAAGTGGGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118921146 14:70151004-70151026 CACCTCAGCCTCTCAAAGTGCGG - Intronic
1119131811 14:72179734-72179756 TAACAGTGATTCTCAAAGTGTGG + Intronic
1119276534 14:73362006-73362028 CACCTCGGCTTCCCAAAGTGTGG - Intronic
1119436480 14:74600818-74600840 AGGCCCTGCTACTCAAAGTGTGG + Intronic
1119541000 14:75438183-75438205 TAACCTTGCTGTTCAAAGTGTGG + Intronic
1119883602 14:78122026-78122048 CATTCTTGCTACTCAAAGTGTGG + Intergenic
1119910924 14:78348623-78348645 GGGCCATGCTTCTCAAAGTGTGG + Intronic
1120051517 14:79872392-79872414 CTACTGTGCTTCTCAAAATGTGG - Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120156350 14:81097574-81097596 CACCCTTGCTACTTAAAGTGTGG - Intronic
1120659328 14:87233718-87233740 AAACCTTCCTACTCAAAGTGTGG + Intergenic
1120847412 14:89138714-89138736 CAACCCTGCTACTCAAAGTGTGG - Intronic
1121024477 14:90604966-90604988 CAGCACTGTTTCTCAAAATGTGG + Intronic
1121034325 14:90687638-90687660 CAAACCTGCTTCACAATGAGGGG + Intronic
1121073956 14:91051328-91051350 CATCTCTGCCTCCCAAAGTGTGG - Intronic
1121099312 14:91239196-91239218 GCACCTTGCTACTCAAAGTGTGG - Intronic
1122301826 14:100735751-100735773 TAACTGTGTTTCTCAAAGTGGGG + Exonic
1122452087 14:101817614-101817636 ACACCCTGCCTCTTAAAGTGCGG - Intronic
1123480085 15:20622993-20623015 GGACAGTGCTTCTCAAAGTGAGG - Intergenic
1123637922 15:22377371-22377393 GGACAGTGCTTCTCAAAGTGAGG + Intergenic
1123991304 15:25685580-25685602 CATCTCTGCCTCCCAAAGTGTGG - Intronic
1124065642 15:26341175-26341197 AAACCTCGCTTCTCAAAGTGTGG - Intergenic
1124495707 15:30185664-30185686 CAAAGCTGCTGCTCACAGTGGGG - Intergenic
1124553743 15:30707253-30707275 GAACAGTGGTTCTCAAAGTGAGG - Intronic
1124677505 15:31698421-31698443 GAACAGTGGTTCTCAAAGTGAGG + Intronic
1124747866 15:32352982-32353004 CAAAGCTGCTGCTCACAGTGGGG + Intergenic
1125038174 15:35151400-35151422 GATGCCTGCTACTCAAAGTGTGG - Intergenic
1125483107 15:40093815-40093837 CATCCTTGCTTCTCAAAGGGTGG + Intronic
1126698313 15:51344128-51344150 CAACCTTACTACTCAAAATGTGG - Intronic
1126928069 15:53613116-53613138 CAAACCTGCTTTTCCAAGTTTGG - Intronic
1127416464 15:58762471-58762493 TAACTCTAGTTCTCAAAGTGTGG - Intergenic
1127800973 15:62477296-62477318 CAGCCTTACTTCTCCAAGTGTGG - Intronic
1127872260 15:63083361-63083383 GAGCCCTGCTACTCAAAGTGTGG - Intergenic
1127904960 15:63369637-63369659 CACCAGTGGTTCTCAAAGTGTGG - Intronic
1128233587 15:66052127-66052149 TAACGCTGCTCCTCAAAGAGAGG + Intronic
1128307567 15:66610013-66610035 CACCCTGGCTTCTCAGAGTGTGG - Intronic
1128317032 15:66667417-66667439 CCACCCTGCTTCTCACAGTGAGG - Intronic
1128538213 15:68506336-68506358 CAGCCCTGATTCTCCAGGTGTGG + Intergenic
1128868951 15:71137614-71137636 CAGCCCTGCTTTTCAAACTGGGG - Intronic
1129127488 15:73455931-73455953 AACCCCTGCCTCTCAAAGTGTGG - Intronic
1129135947 15:73551368-73551390 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1129383561 15:75183168-75183190 CCAGCCTGCCTCTAAAAGTGGGG + Intergenic
1129509264 15:76108571-76108593 GATCCTTGCTTTTCAAAGTGCGG - Intronic
1129756714 15:78103261-78103283 GAACCCTGCATCTGAAATTGGGG + Intronic
1130183875 15:81659853-81659875 GATCCCTGCTACTCAAAATGTGG - Intergenic
1130188178 15:81705731-81705753 GATCCCTGCTACTCAAAATGTGG - Intergenic
1130704785 15:86223040-86223062 GAATCTTGCTACTCAAAGTGTGG - Intronic
1131572580 15:93554042-93554064 CAAGCGTGGTTCTCAGAGTGGGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131804883 15:96110882-96110904 CATCAGTGGTTCTCAAAGTGTGG + Intergenic
1133073555 16:3262962-3262984 GAAGCCAGCTTCCCAAAGTGGGG + Intergenic
1133262767 16:4562224-4562246 CACCTCAGCCTCTCAAAGTGCGG - Intronic
1133420432 16:5642033-5642055 CAGTCTTGCTCCTCAAAGTGTGG - Intergenic
1133439406 16:5807856-5807878 GCTCCCTGCTCCTCAAAGTGTGG - Intergenic
1133646117 16:7766324-7766346 CACCCATGCTACTCTAAGTGTGG + Intergenic
1133824028 16:9261164-9261186 AATCCTTGCTGCTCAAAGTGTGG - Intergenic
1133838225 16:9385435-9385457 CACCCCCGCCTCTCCAAGTGTGG + Intergenic
1134559459 16:15195664-15195686 CACCTCAGTTTCTCAAAGTGAGG + Intergenic
1134900860 16:17936589-17936611 CATCCTTGCTACTCAAACTGTGG + Intergenic
1134908209 16:18000276-18000298 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1134919998 16:18107275-18107297 CACCTCAGTTTCTCAAAGTGAGG + Intergenic
1135249306 16:20887450-20887472 AATCACTGTTTCTCAAAGTGTGG - Intronic
1135987702 16:27196117-27196139 CAAGCCTGCCACTCAAAGGGAGG + Intergenic
1136076027 16:27817845-27817867 GAACAGTGCTACTCAAAGTGTGG - Intronic
1137891447 16:52166924-52166946 GAACAATGGTTCTCAAAGTGAGG + Intergenic
1137930219 16:52580100-52580122 GAACCTTGCTACTCAAAGTGTGG + Intergenic
1138828103 16:60345625-60345647 GGACTCTGCTTCTCAAAATGTGG - Intergenic
1138911174 16:61401054-61401076 AAACAGTGGTTCTCAAAGTGCGG + Intergenic
1139158128 16:64469020-64469042 AATCACTGTTTCTCAAAGTGAGG - Intergenic
1139942225 16:70613514-70613536 GAACCTTGGTACTCAAAGTGTGG + Intronic
1140036871 16:71377863-71377885 GAGCTCTGCTACTCAAAGTGTGG + Intronic
1140569398 16:76085826-76085848 CACCCCAGCCTCCCAAAGTGAGG - Intergenic
1140599427 16:76457606-76457628 GAGCCCTGCTACTCAAAGTATGG + Intronic
1140908393 16:79429597-79429619 CAACTTTGCTGCTCACAGTGGGG - Intergenic
1141098258 16:81178210-81178232 CTGCCCAGTTTCTCAAAGTGAGG - Intergenic
1141124696 16:81392758-81392780 CAGCTCTGCTTTTAAAAGTGAGG + Intergenic
1141837143 16:86549148-86549170 GAACAGGGCTTCTCAAAGTGAGG + Intronic
1142343642 16:89539821-89539843 CACCTCAGCTCCTCAAAGTGTGG + Intronic
1143120741 17:4605082-4605104 CCACCCTGCTTCTTAAAGCAAGG + Intronic
1143158677 17:4854822-4854844 TAACCCTGCCTCTCACACTGTGG - Intronic
1143589229 17:7870973-7870995 CACCCCAGCTTCCCAAAGTGTGG + Intronic
1143857660 17:9864194-9864216 CAACCTTGCTTTTCAAAGGATGG + Intronic
1143870152 17:9952228-9952250 GAATGCTGGTTCTCAAAGTGTGG - Intronic
1143940141 17:10532066-10532088 CATCACTGCTTCTCAAACTTTGG + Intronic
1144214849 17:13046412-13046434 CAACTGTGCTATTCAAAGTGTGG + Intergenic
1144314492 17:14046951-14046973 AAACCCTGCTACTAAAAGTGTGG + Intergenic
1144734310 17:17546422-17546444 CAAGCCTGCTTCTGAAAATGTGG - Intronic
1145283378 17:21485212-21485234 AAAACCTGATTCTCAATGTGAGG + Intergenic
1145394108 17:22480618-22480640 AAAACCTGATTCTCAACGTGAGG - Intergenic
1146211251 17:30945409-30945431 GGACCCTGCTTCTCAACATGTGG + Intronic
1146718895 17:35109113-35109135 CAACACAGCCTCCCAAAGTGCGG + Intronic
1147443898 17:40463346-40463368 CAAACCTGCCTCTGAAAGAGAGG + Intergenic
1148037754 17:44680912-44680934 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1149867489 17:60158768-60158790 AAACAGTGGTTCTCAAAGTGCGG + Intronic
1150215388 17:63465842-63465864 CACCTCAGCTTCCCAAAGTGCGG - Intergenic
1150314910 17:64160723-64160745 CAAATCTGCTTCTCAAAGGCTGG + Intronic
1150377646 17:64695143-64695165 TGAACCTGCTCCTCAAAGTGTGG + Intergenic
1150552291 17:66221868-66221890 GATCCCTGCTGCTCAAAATGTGG + Intronic
1150777022 17:68089352-68089374 TGAACCTGCTCCTCAAAGTGTGG - Intergenic
1151343603 17:73487524-73487546 CAGCCCTGCTGCTCACAGTGAGG + Intronic
1151389275 17:73774836-73774858 GAACCCTGCATCTGACAGTGTGG - Intergenic
1151954827 17:77374976-77374998 CATCCCTGCTTCCCAGAGGGAGG + Intronic
1151993152 17:77591591-77591613 TTACCTGGCTTCTCAAAGTGTGG - Intergenic
1152479450 17:80540483-80540505 CACCTCAGCTTCCCAAAGTGTGG + Intergenic
1152494316 17:80660502-80660524 CAACTCTGCTCCTCAGAGTGTGG - Intronic
1152740993 17:82018274-82018296 CAGCCCTGCGTCTCCAAGGGTGG + Intergenic
1153863645 18:9240166-9240188 TAAAACTGCTACTCAAAGTGTGG - Intronic
1153947522 18:10030846-10030868 GAACAGTGGTTCTCAAAGTGGGG - Intergenic
1154958691 18:21286176-21286198 AACCACTGCTTCTGAAAGTGTGG - Intronic
1154975794 18:21456254-21456276 GAGCCATGCTACTCAAAGTGTGG - Intronic
1155237747 18:23838372-23838394 AGAGCCTGCTTTTCAAAGTGAGG - Intronic
1155920417 18:31597739-31597761 CAGCCTTGGTTCTCAGAGTGAGG - Intronic
1157108077 18:44793436-44793458 GATCAGTGCTTCTCAAAGTGTGG + Intronic
1158038206 18:53060280-53060302 CACCTCTGCTTCCCAAAGTGTGG + Intronic
1158162074 18:54496428-54496450 GACCTGTGCTTCTCAAAGTGGGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1159865267 18:73696375-73696397 CAACCCTGATTGTCATAGGGAGG + Intergenic
1159913696 18:74170056-74170078 CCACCTTGCTTCTCACTGTGTGG + Intergenic
1162854808 19:13460129-13460151 GACCCTTGCTACTCAAAGTGTGG + Intronic
1163040844 19:14601149-14601171 CACCTCTGCCTCCCAAAGTGCGG + Intronic
1163424561 19:17234377-17234399 CAACTCTGCTTCCTAAAGTGCGG + Intronic
1163626033 19:18390291-18390313 CAACCAGGCTCCGCAAAGTGGGG - Intergenic
1163805856 19:19396953-19396975 CAACTCAGCATCCCAAAGTGTGG + Intronic
1164641323 19:29828117-29828139 CAACTCAGCCTCCCAAAGTGTGG - Intergenic
1164663795 19:30007290-30007312 CAGCCTTGCTACTCAAAGTGTGG - Intronic
1164863442 19:31582049-31582071 CACCTCAGCTTCCCAAAGTGTGG - Intergenic
1165612728 19:37170327-37170349 CAGCGCTGGTTCTCAAAGTGTGG - Intronic
1166050021 19:40253318-40253340 GAAGACTGTTTCTCAAAGTGAGG + Intronic
1166254714 19:41595137-41595159 GAGCCTTGCTACTCAAAGTGTGG + Intronic
1166259389 19:41627224-41627246 CAACCCTGCTTCTCAAAGTGTGG - Intronic
1166274898 19:41746458-41746480 AACCCTTGCTACTCAAAGTGTGG + Intronic
1166279941 19:41785410-41785432 AACCCTTGCTACTCAAAGTGTGG + Intergenic
1166337097 19:42114889-42114911 CACCTTGGCTTCTCAAAGTGCGG - Intronic
1166343918 19:42153799-42153821 CAACCCTGAGTCTCTGAGTGGGG + Intronic
1166407008 19:42528626-42528648 CAGCCTTGATTCTCAAAGTGTGG - Intronic
1166412802 19:42567786-42567808 AAGCCTTGCTACTCAAAGTGTGG - Intergenic
1167844711 19:52152510-52152532 CAAGCCTGCTTCTCCAAGATTGG - Intergenic
1168387448 19:55976447-55976469 GAGCCGTGGTTCTCAAAGTGTGG + Intronic
925008047 2:460597-460619 CAAACCTACTTCTCAAAGCCTGG - Intergenic
925226705 2:2189806-2189828 GAACCCTGCTTCTCCCCGTGCGG - Intronic
925697430 2:6595675-6595697 CAACAGGGCTTCTCAAACTGGGG + Intergenic
925823580 2:7824380-7824402 TACCTCTGCTTCTCACAGTGGGG - Intergenic
926054674 2:9767654-9767676 CACCCTTGCAGCTCAAAGTGTGG + Intergenic
926727025 2:16006515-16006537 CATCTCTGCTTCCCATAGTGGGG - Intergenic
927493753 2:23538289-23538311 CATCTTTGTTTCTCAAAGTGTGG - Intronic
927524189 2:23721883-23721905 CCAGCCTGCTTCTCAGATTGAGG - Intergenic
928393554 2:30927314-30927336 GAACCTTGCTCCTCAAATTGTGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929437862 2:41941917-41941939 GAACCCAGCTGCTCCAAGTGTGG + Intronic
930039501 2:47109306-47109328 CACCTCTGCCTCCCAAAGTGTGG - Intronic
931267734 2:60675333-60675355 CAACCCTGCTACTCAAAGGGTGG - Intergenic
931923149 2:67042915-67042937 AAGCACTGGTTCTCAAAGTGTGG + Intergenic
932254738 2:70274810-70274832 CACCTCTGCCTCCCAAAGTGTGG + Intronic
932293618 2:70606331-70606353 CAGACCTGCTTCTCACAGTTTGG + Intergenic
932554014 2:72802788-72802810 CAGCAGTGGTTCTCAAAGTGTGG + Intronic
932698514 2:73977195-73977217 AACTCCTGCTACTCAAAGTGTGG - Intergenic
932733155 2:74234723-74234745 GAACAGTGATTCTCAAAGTGTGG - Intronic
932963955 2:76448572-76448594 AAACACTGTTTATCAAAGTGAGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933538094 2:83602791-83602813 CCACCCAGCCTCTGAAAGTGGGG - Intergenic
933600289 2:84321961-84321983 GTGCCCTGCTACTCAAAGTGTGG - Intergenic
934045416 2:88169651-88169673 GAGCCTTGCTTCTCAAACTGCGG - Intergenic
934903826 2:98181903-98181925 CCTCTCTGCTTCTCAAGGTGTGG - Intronic
934992723 2:98932946-98932968 CACCCCTGCTCCTCCAGGTGGGG - Intronic
935278920 2:101500920-101500942 CAACTGTGCTTCTAAAAGGGAGG + Intergenic
935282673 2:101532700-101532722 CGCCCCTGCTACTCAAAGAGTGG - Intergenic
935623440 2:105148264-105148286 CTGCAGTGCTTCTCAAAGTGGGG + Intergenic
935793082 2:106611990-106612012 TATCCCTGCTGCTCAAAGTTAGG - Intergenic
936688722 2:114860019-114860041 TACCCTTGCTTCTCAAAGTATGG - Intronic
937056505 2:118941835-118941857 CATCCTTGCTGCTCAAAGTGTGG - Intergenic
937197601 2:120173493-120173515 TGTCCCTGGTTCTCAAAGTGGGG - Intronic
937385241 2:121424829-121424851 CAACACTGCTTCTAATTGTGGGG + Intronic
937437256 2:121890603-121890625 CAACTGTGCTTCTCAAGGTGTGG - Intergenic
937822560 2:126327310-126327332 CATCCTTGCTACTCAAAATGTGG - Intergenic
938242680 2:129755515-129755537 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
938406489 2:131035782-131035804 CACCCCTGCTGCACAAACTGCGG + Intronic
938796577 2:134722459-134722481 GATCCTTGCTTCTCAAAGTGTGG - Intergenic
938922732 2:136009796-136009818 GTACCATACTTCTCAAAGTGTGG - Intergenic
938971306 2:136435401-136435423 CACCTCGGCTTCCCAAAGTGTGG + Intergenic
940409209 2:153340877-153340899 GAACACTGGATCTCAAAGTGTGG + Intergenic
940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG + Intergenic
941209164 2:162614351-162614373 CAGCAATGCTACTCAAAGTGTGG - Intronic
941366189 2:164614087-164614109 CAGCTGCGCTTCTCAAAGTGTGG - Intronic
941398676 2:165003709-165003731 GACCCCTGCTACTCAAAGTATGG - Intergenic
941432850 2:165432772-165432794 CTACTCTGCTACTCAAAGTGTGG + Intergenic
941490871 2:166140864-166140886 AAACCTTGCTTCTGAAAGTGTGG + Intergenic
941632735 2:167902820-167902842 CATCTCAGCTTCCCAAAGTGCGG - Intergenic
941925335 2:170888633-170888655 CACCCTTGCCACTCAAAGTGTGG + Intergenic
942799158 2:179856969-179856991 GCACCTTGCTTCTCAAAGCGTGG + Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944504222 2:200393092-200393114 CAACCCAGATTCTCAAATTGGGG - Intronic
945288250 2:208103679-208103701 AAGCCTTTCTTCTCAAAGTGTGG - Intergenic
945706719 2:213243804-213243826 CACCCTTGCTACTGAAAGTGTGG + Intergenic
945783550 2:214205944-214205966 CACCTCGGCCTCTCAAAGTGTGG - Intronic
946055577 2:216898652-216898674 CACCCTTGCCACTCAAAGTGAGG + Intergenic
946598123 2:221328836-221328858 AATCCTTGCTACTCAAAGTGTGG + Intergenic
946654963 2:221936583-221936605 CACCTCGGCTTCCCAAAGTGTGG - Intergenic
946722520 2:222625470-222625492 GAACCTTGCTACTCAAAATGCGG + Intronic
947164112 2:227244099-227244121 AACCCTTGCTACTCAAAGTGGGG - Intronic
947328826 2:229006815-229006837 TAACAGTGGTTCTCAAAGTGTGG - Intronic
947885815 2:233570102-233570124 CACCTCAGCTTCCCAAAGTGCGG + Intergenic
948107460 2:235427140-235427162 CTGCCGTGATTCTCAAAGTGTGG - Intergenic
1168968896 20:1917359-1917381 CAGCTATGCTTGTCAAAGTGTGG + Intronic
1169065230 20:2691460-2691482 AAATCTTGCTTCTCACAGTGTGG - Intergenic
1169286812 20:4315155-4315177 GGCCCTTGCTTCTCAAAGTGTGG - Intergenic
1169413268 20:5392937-5392959 TAAACTTGCTGCTCAAAGTGGGG - Intergenic
1169528393 20:6455550-6455572 CACCAGTGCTTCTCAAAGAGTGG + Intergenic
1169738123 20:8859466-8859488 AAGCCTTGCTACTCAAAGTGTGG - Intronic
1169806201 20:9561859-9561881 GAACCTTGCTTCTCCAAGTATGG + Intronic
1169855024 20:10092925-10092947 GAACACTGGTTCTCAAAGTGGGG - Intergenic
1170417252 20:16157719-16157741 CAGCCTTGCTACTTAAAGTGTGG - Intergenic
1170763557 20:19272541-19272563 CAGCCTTGCTTCTCAAAGTGTGG - Intronic
1170891378 20:20378943-20378965 GAGCCCTGCCACTCAAAGTGTGG + Intergenic
1171109481 20:22467015-22467037 CGACCCTGCTTCACACAATGGGG - Intergenic
1172297047 20:33819822-33819844 CAAGCTTTCTGCTCAAAGTGTGG + Intronic
1172557658 20:35856495-35856517 AACCAGTGCTTCTCAAAGTGTGG - Intronic
1172884834 20:38223898-38223920 CACCAGTGGTTCTCAAAGTGTGG - Intronic
1172885204 20:38226365-38226387 TATTCCTGCTACTCAAAGTGTGG + Intronic
1173216604 20:41090752-41090774 CACCCCAGCCTCCCAAAGTGCGG + Intronic
1173245708 20:41336037-41336059 CAACAGTGATTCTTAAAGTGTGG - Intergenic
1173387953 20:42605964-42605986 GAGCCTTGCTGCTCAAAGTGTGG + Intronic
1173703903 20:45096240-45096262 GAGCCTTGCTACTCAAAGTGAGG - Intronic
1174794974 20:53514335-53514357 CGGACCTGGTTCTCAAAGTGTGG - Intergenic
1174797162 20:53531773-53531795 GATCCTTGCTTCTCAAAGTGTGG + Intergenic
1175166203 20:57046595-57046617 GGACCTTGCTACTCAAAGTGTGG - Intergenic
1175308156 20:57992179-57992201 CAACCTTGCTACTCAAAGTGTGG + Intergenic
1175549638 20:59808789-59808811 GACCCTCGCTTCTCAAAGTGTGG - Intronic
1176246489 20:64099669-64099691 CAGCCCTGCTTCTCAGTGTGGGG + Exonic
1176664581 21:9673612-9673634 GAACATTGATTCTCAAAGTGTGG - Intergenic
1176804581 21:13467399-13467421 CACCTCGGCCTCTCAAAGTGCGG + Intergenic
1178259011 21:31081537-31081559 CAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1178519499 21:33276674-33276696 CAGCCCTGACTCTCAAGGTGTGG - Exonic
1179180518 21:39040968-39040990 CGCCCGTGGTTCTCAAAGTGTGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179444196 21:41420168-41420190 GACCCGTGCTTCTCAAAGGGTGG - Intergenic
1179898522 21:44376931-44376953 CAAGCAGGGTTCTCAAAGTGTGG - Intronic
1180678692 22:17607698-17607720 AAACACTATTTCTCAAAGTGTGG + Intronic
1180965723 22:19787127-19787149 CAACCATGTTCCTCACAGTGGGG + Exonic
1181856789 22:25787432-25787454 CAACAGTGGTTCTCAAAGCGGGG - Intronic
1182085194 22:27556509-27556531 CACCCCGGCCTCCCAAAGTGCGG + Intergenic
1182494544 22:30696519-30696541 AAACAGTGCTTCTCAGAGTGTGG - Intronic
1182846600 22:33436397-33436419 GAACTCTGCCTCTCTAAGTGTGG + Intronic
1183245310 22:36688759-36688781 AAGCCTTGCTTCTCAAACTGTGG + Intronic
1183405231 22:37627251-37627273 CAGCCCAGCTGCTCAGAGTGTGG - Intronic
1183675023 22:39294441-39294463 CAACTCTGCTTCTGAAATAGGGG - Intergenic
1184010195 22:41742009-41742031 CACCACAGCTTCCCAAAGTGTGG - Intronic
949937441 3:9127024-9127046 AACCCTTGCTACTCAAAGTGTGG + Intronic
950160463 3:10756911-10756933 AAACCTTGATACTCAAAGTGAGG + Intergenic
950196093 3:11010344-11010366 GGGCCTTGCTTCTCAAAGTGCGG - Intronic
950335310 3:12188468-12188490 CACCCCTGCTTCTCAGAGTGAGG + Intronic
950892930 3:16420950-16420972 GAATCTTGCTACTCAAAGTGTGG - Intronic
950999767 3:17544225-17544247 CAACAGTCGTTCTCAAAGTGTGG - Intronic
951256771 3:20458890-20458912 AAGCCTTGCTCCTCAAAGTGTGG - Intergenic
951850293 3:27131951-27131973 TAACCCTTCTTTTCAAATTGTGG + Intronic
951941309 3:28081835-28081857 AAGCCTTGCATCTCAAAGTGTGG + Intergenic
952187354 3:30984405-30984427 GAACCCTGCCTCTCAAAGGGTGG - Intergenic
952279524 3:31909807-31909829 CAAAGCTGCTACTCAGAGTGGGG - Intronic
952538248 3:34336621-34336643 CCACCCTGCTTTTCAGAGTGTGG + Intergenic
952857061 3:37780951-37780973 GACCCTTGCTACTCAAAGTGTGG + Intronic
952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG + Intronic
952907366 3:38150620-38150642 GAACGCTGCTACTCAAAGTGTGG + Intergenic
953287646 3:41628124-41628146 GAACACTGCTAATCAAAGTGTGG + Intronic
953664692 3:44917460-44917482 CAACCTTACTTCTCAAAGCCAGG + Intronic
953891043 3:46751715-46751737 GAGCATTGCTTCTCAAAGTGAGG + Intronic
955129690 3:56153287-56153309 GATCCATGCTACTCAAAGTGTGG + Intronic
955956031 3:64291269-64291291 GAATCTTGCTACTCAAAGTGTGG + Intronic
956619665 3:71208801-71208823 CGACCTTGATTCTCAAAGAGTGG - Intronic
956869065 3:73398556-73398578 GAACCCTGTTGTTCAAAGTGTGG - Intronic
956933059 3:74068052-74068074 GAACAGTGGTTCTCAAAGTGTGG + Intergenic
957785339 3:84875354-84875376 AAACAATGCTACTCAAAGTGAGG - Intergenic
958995360 3:100898371-100898393 AAATCATACTTCTCAAAGTGTGG - Intronic
959348051 3:105224104-105224126 CACCTCTGCCTCCCAAAGTGCGG + Intergenic
960099419 3:113724592-113724614 CAACTCTGGTTCTGAAAATGGGG - Intronic
960536972 3:118825510-118825532 TAACACTGATTCTCAAAATGTGG + Intergenic
960891296 3:122451187-122451209 AAACAGTGGTTCTCAAAGTGTGG - Intronic
960991552 3:123314822-123314844 CACCCTTGTTTCTCAAAGAGTGG - Intronic
961060263 3:123822725-123822747 CAACCCTTCTACTCAGAGTTGGG + Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961962981 3:130871501-130871523 CAACAGTGGTTCTGAAAGTGTGG - Intronic
961980110 3:131068227-131068249 CAGCCTTGCTACTCAAAGTATGG + Intronic
962337187 3:134545243-134545265 CACCTCAGCCTCTCAAAGTGCGG + Intronic
962932631 3:140051981-140052003 AGGCCATGCTTCTCAAAGTGGGG - Intronic
962983247 3:140509456-140509478 GAACAGTGGTTCTCAAAGTGTGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963724377 3:148903522-148903544 CATCAGTGGTTCTCAAAGTGTGG - Intergenic
963760429 3:149282769-149282791 GACTCTTGCTTCTCAAAGTGTGG - Intergenic
964097911 3:152954770-152954792 CAAACTTGCTACTCAAAATGAGG - Intergenic
964112965 3:153106394-153106416 CACCTCGGCTTCCCAAAGTGTGG - Intergenic
964344532 3:155743281-155743303 CACCTCTGCCTCCCAAAGTGTGG - Intronic
966419010 3:179719075-179719097 GAACCTGGCTTCTCAAAGTGGGG - Intronic
966580560 3:181557655-181557677 ACACCTTGCTTCTCAAAGTATGG + Intergenic
966621130 3:181965063-181965085 CACCTCGGCTTCCCAAAGTGCGG + Intergenic
966723092 3:183084249-183084271 AAATCTTGCTACTCAAAGTGTGG - Intronic
967098384 3:186195690-186195712 CAGCCTTACTACTCAAAGTGTGG - Intronic
967130821 3:186469250-186469272 CAACCCAGCTTCCCAGACTGAGG - Intergenic
967218057 3:187226863-187226885 AGGCCTTGCTTCTCAAAGTGTGG + Intronic
967314485 3:188138274-188138296 AGGCCTTGCTTCTCAAAGTGTGG - Intergenic
967576118 3:191095981-191096003 AAACAGTGCTACTCAAAGTGTGG - Intergenic
968230029 3:197000059-197000081 AAGGCTTGCTTCTCAAAGTGTGG + Intronic
968832360 4:2939523-2939545 CACCCCGGCTGGTCAAAGTGTGG - Exonic
969643333 4:8412230-8412252 CAAGGCTCCTTCTCAGAGTGGGG - Intronic
970710153 4:18852290-18852312 CACCCTTGCTACTCAAAGTATGG + Intergenic
970809363 4:20073627-20073649 CAAACATGGTTCTCAAAGTGTGG + Intergenic
971747609 4:30604253-30604275 CAACCTTGCTGCTCATAGCGTGG + Intergenic
971904264 4:32705675-32705697 CAGCCTTGCTTCTCAAAGTGTGG + Intergenic
972199753 4:36700790-36700812 AGATCTTGCTTCTCAAAGTGTGG + Intergenic
972308063 4:37851321-37851343 AAACAGTGGTTCTCAAAGTGAGG - Intronic
972572539 4:40323945-40323967 AAACCTTGCTACTCAATGTGTGG + Intergenic
972741637 4:41892753-41892775 TATCCTAGCTTCTCAAAGTGTGG + Intergenic
973618955 4:52708749-52708771 CATCCTTGCTTCTCAAAGCGTGG - Intergenic
974403759 4:61438953-61438975 CACCTCTGCCTCCCAAAGTGCGG + Intronic
974807347 4:66897930-66897952 CACCTCTGCCTCCCAAAGTGCGG + Intergenic
975573698 4:75842450-75842472 GGACCTTGCTACTCAAAGTGTGG + Intergenic
975792493 4:77969307-77969329 CACCTCGGCCTCTCAAAGTGCGG - Intergenic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976164710 4:82241990-82242012 GAACACTGATTCTCAAAGTTTGG + Intergenic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977498067 4:97802117-97802139 AAACAGTGTTTCTCAAAGTGTGG - Intronic
977529771 4:98186431-98186453 CACCTCGGCTTCTTAAAGTGCGG - Intergenic
978048582 4:104166503-104166525 CACCTCGGCTTCTCAAAGTGCGG + Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978503000 4:109428934-109428956 GAACCTTGCTACTCAAAGTGTGG + Intergenic
978524961 4:109655793-109655815 AAGCCCAGCTTCTCACAGTGTGG + Intronic
979293978 4:119009970-119009992 CATCCTTGCTACTCAAGGTGAGG - Intronic
979431103 4:120632209-120632231 TAAACTTGCTACTCAAAGTGTGG + Intergenic
979655172 4:123184042-123184064 CAACTTGGCTTCCCAAAGTGTGG + Intronic
979689851 4:123548372-123548394 TATCCCTGCTTCTCAGAGAGAGG - Intergenic
980158496 4:129133687-129133709 CAGCCCTGGATCTGAAAGTGTGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982074386 4:151724100-151724122 GAAGCCTGTTTCTCAAATTGGGG - Intronic
983264611 4:165494910-165494932 AAACCTTGCTCTTCAAAGTGTGG + Intronic
983574264 4:169242998-169243020 CAATGCTGTTTCTCAAAGTCTGG - Intronic
983642077 4:169952262-169952284 GAGCACTGGTTCTCAAAGTGAGG + Intergenic
983701477 4:170600689-170600711 CAGCCATGGTTCTCAAAGTGTGG + Intergenic
983725225 4:170914421-170914443 AAGCCCTGCTTCCCAAACTGGGG - Intergenic
984411190 4:179400386-179400408 CAACTCGGCCTTTCAAAGTGTGG - Intergenic
984882937 4:184426262-184426284 CAACTCAGCCTCCCAAAGTGCGG + Intronic
984956682 4:185052279-185052301 CACCCCAGCCTCCCAAAGTGCGG + Intergenic
984972791 4:185205578-185205600 CACCTCAGCCTCTCAAAGTGCGG - Intronic
985410055 4:189674271-189674293 GAACATTGATTCTCAAAGTGTGG - Intergenic
986171041 5:5314864-5314886 AAACCTTGCTACTCACAGTGAGG - Intronic
986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG + Intergenic
986320035 5:6623226-6623248 CACCACTGCTCCTCAACGTGCGG - Exonic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
986638419 5:9847875-9847897 CACCAGTGGTTCTCAAAGTGTGG + Intergenic
987087237 5:14482287-14482309 GAACAGTGGTTCTCAAAGTGTGG - Intronic
987225776 5:15839838-15839860 CAACTCTCCTTCCAAAAGTGGGG - Intronic
987381925 5:17293538-17293560 AAACCTTGCTACTCAATGTGTGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988993558 5:36693497-36693519 CAGCACTGATTCTCAAAGTGTGG + Intergenic
989001281 5:36763119-36763141 CATCAGTGGTTCTCAAAGTGTGG - Intergenic
989182954 5:38596549-38596571 CAGCAATGGTTCTCAAAGTGTGG - Intronic
989269271 5:39512835-39512857 AAACCCTGATACTTAAAGTGTGG - Intergenic
989552602 5:42753358-42753380 GGCCCCTGCTTTTCAAAGTGTGG - Intergenic
989866940 5:46525075-46525097 CAACCCTTCTTTTGATAGTGCGG + Intergenic
990241171 5:53818124-53818146 CTGCCTTGCTGCTCAAAGTGTGG + Intergenic
990380282 5:55216230-55216252 CAACAGTGGGTCTCAAAGTGTGG + Intergenic
990490913 5:56302052-56302074 GAACCTTGTTACTCAAAGTGTGG + Intergenic
990637418 5:57744510-57744532 CAACCTTGCTACTCAAAATGTGG + Intergenic
991068554 5:62451583-62451605 AAACAGTGGTTCTCAAAGTGTGG - Intronic
991364543 5:65854565-65854587 CACCTCAGCCTCTCAAAGTGTGG - Intronic
991597176 5:68317527-68317549 CACCAGTGGTTCTCAAAGTGTGG + Intergenic
992112260 5:73506738-73506760 CAATCATGCTACTCAAAGTAGGG - Intergenic
992539813 5:77752939-77752961 CACCTCAGCCTCTCAAAGTGCGG + Intronic
993396811 5:87399543-87399565 CAAACCTCCTTCTCATAGTAAGG + Intronic
993752258 5:91684769-91684791 GCAGCCTGCTTCTCAGAGTGAGG - Intergenic
994062475 5:95495691-95495713 AAACCCTGCTGATCAAACTGTGG + Intronic
994523480 5:100873085-100873107 AATCCTTGCTACTCAAAGTGTGG - Intronic
995026225 5:107426333-107426355 TAATCTTGCTACTCAAAGTGTGG + Intronic
995239708 5:109872189-109872211 GAATCCTGCTAGTCAAAGTGTGG + Intergenic
995461876 5:112411853-112411875 CAAGCCTGCTTCTCAAACACAGG + Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995836131 5:116401366-116401388 CAGCCTTGCTACTCAAAGTGTGG - Intronic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
995922804 5:117333914-117333936 CAGTCTTGCTACTCAAAGTGTGG - Intergenic
996373473 5:122777141-122777163 AAACAGTGCTTCTCAAACTGTGG + Intronic
996728626 5:126695615-126695637 CCTCACTGCTACTCAAAGTGTGG + Intergenic
996781398 5:127190767-127190789 AAACCATGCTACTCAAAGGGTGG - Intergenic
997333060 5:133081294-133081316 CGCCTCTGCCTCTCAAAGTGCGG + Intronic
998867138 5:146516664-146516686 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
999651200 5:153769186-153769208 CAATACTGTTTCTCAAAGTGAGG + Intronic
999662998 5:153884992-153885014 CAATCTTGTTCCTCAAAGTGTGG - Intergenic
999718022 5:154377589-154377611 AACCAGTGCTTCTCAAAGTGTGG - Intronic
999917895 5:156283804-156283826 GAACACTGCTTCTCAACGTGTGG - Intronic
999960702 5:156753019-156753041 GAGCCGTGCTTCTCAAAGTGTGG + Intronic
1000013416 5:157255564-157255586 GAGCCCTGCTACTCAAAGTGTGG + Intergenic
1000089034 5:157913899-157913921 CAAGCCAGATTCACAAAGTGGGG + Intergenic
1000100418 5:158011072-158011094 CCTCCTTGCTACTCAAAGTGTGG - Intergenic
1000274605 5:159722345-159722367 CAACCCTAGTCCTCAAAGTATGG - Intergenic
1000288641 5:159849327-159849349 GAACCTTGCTACTCAAAGTGTGG - Intergenic
1000368663 5:160514434-160514456 GAACAGTGCTACTCAAAGTGTGG + Intergenic
1000448023 5:161348601-161348623 GAACTGTGATTCTCAAAGTGTGG - Intronic
1001017395 5:168153829-168153851 GAGCAGTGCTTCTCAAAGTGTGG - Intronic
1001571209 5:172731908-172731930 GAACATTGGTTCTCAAAGTGTGG - Intergenic
1001756931 5:174177640-174177662 AACCAGTGCTTCTCAAAGTGAGG + Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1003279047 6:4676194-4676216 CAGCAGCGCTTCTCAAAGTGAGG - Intergenic
1003720344 6:8694391-8694413 CACCGCTGTTTCTCAAATTGTGG - Intergenic
1004136161 6:12969048-12969070 GAACCTTGTTTCTCCAAGTGTGG - Intronic
1004544091 6:16580423-16580445 AAACCATACTACTCAAAGTGCGG - Intronic
1004595865 6:17099189-17099211 CACCCTTGCTACTCAAAGTCTGG + Intergenic
1004639372 6:17499598-17499620 CACCCCAGCCTCTCAAAGTCTGG - Intronic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1004915613 6:20329184-20329206 CAGGCTTGCTTCTCAAAGGGTGG - Intergenic
1005398725 6:25409915-25409937 CAGCGGTGCTTCTCAAACTGAGG - Intronic
1006143042 6:31942538-31942560 CCACCTTGCCTCCCAAAGTGGGG + Intronic
1006189381 6:32198285-32198307 GAACAATGATTCTCAAAGTGTGG - Intronic
1006479894 6:34283674-34283696 AAACCCTGCCTCTAAAAGGGCGG - Exonic
1007189430 6:40000726-40000748 AAACAATGCTTCTCAAAGTGTGG - Intergenic
1007210450 6:40189658-40189680 CAACCCTGGTTTTCACTGTGTGG + Intergenic
1007259334 6:40552094-40552116 ACACCGTGGTTCTCAAAGTGTGG + Intronic
1008334910 6:50291222-50291244 AAGCCCTGTTCCTCAAAGTGTGG + Intergenic
1009658032 6:66570750-66570772 GAACAGTGATTCTCAAAGTGTGG + Intergenic
1010792854 6:80084773-80084795 GAACACTGGTTCTCAAAGAGGGG - Intergenic
1011571650 6:88743799-88743821 CAATTCTGCTTCTGAAAATGAGG - Intronic
1011774777 6:90717465-90717487 CAGCCTTGTTACTCAAAGTGTGG + Intergenic
1011819532 6:91235232-91235254 GAACCTTGCTACTCAATGTGAGG + Intergenic
1012172545 6:96036976-96036998 GACCCTTGCTTGTCAAAGTGTGG - Intronic
1012389350 6:98719799-98719821 AAAAGGTGCTTCTCAAAGTGAGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013185126 6:107750850-107750872 CAACCTTGCTACTCGAAGTGTGG - Intronic
1013489339 6:110630058-110630080 AAATTGTGCTTCTCAAAGTGTGG + Intronic
1013833661 6:114305904-114305926 CAATCCTGCTTCTCAAATTGTGG - Intronic
1014052236 6:116968290-116968312 CAACCTGGCTTTTCAAAGTGTGG - Intergenic
1014685563 6:124495583-124495605 AGACCTTGCTCCTCAAAGTGTGG - Intronic
1014839890 6:126206435-126206457 AACCCTTGCTACTCAAAGTGTGG - Intergenic
1015051093 6:128841085-128841107 CAACAGTGATTCTCCAAGTGTGG - Intergenic
1015461796 6:133500115-133500137 CAGTCTTGCTACTCAAAGTGTGG - Intronic
1015768804 6:136747801-136747823 CACCCTTGCTACTCAAAATGTGG - Intronic
1016085909 6:139913982-139914004 GACCCCTGCTACTCAAAGTATGG - Intergenic
1016321134 6:142846971-142846993 CAGCATGGCTTCTCAAAGTGGGG - Intronic
1016661353 6:146584783-146584805 CAACTCGGCTTCCCAAAGTCTGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017128084 6:151084525-151084547 CACCTCGGCTTCCCAAAGTGTGG + Intronic
1017313479 6:153002108-153002130 CAGCGGTGTTTCTCAAAGTGTGG - Intronic
1017595784 6:156027309-156027331 CAACTCCGTTTCTCAAACTGGGG + Intergenic
1018157234 6:160996933-160996955 CACCCCTGCTTCTGAATGAGAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019668229 7:2263480-2263502 GGACCCTGCTGCTCAAAGAGTGG + Intronic
1021750153 7:23790112-23790134 GATCCTTGCTTCTCAAAGTATGG - Intronic
1022501630 7:30885673-30885695 CTTACCTGGTTCTCAAAGTGTGG - Intronic
1022922170 7:35026582-35026604 TGACACTGCTTCTCAAAGTTTGG - Intronic
1023523993 7:41079696-41079718 CAATGGTGGTTCTCAAAGTGTGG - Intergenic
1023541147 7:41267515-41267537 CACCCTTGCTACTCACAGTGTGG + Intergenic
1023868046 7:44248200-44248222 CAACCCTTCCTCTCATAGTCAGG + Intronic
1024747724 7:52427547-52427569 CAGCCCTGCTTCACAAGGAGTGG + Intergenic
1024878831 7:54060904-54060926 CAACATTGCTTTTCAAAGAGTGG - Intergenic
1026084214 7:67249583-67249605 CAACAATGGTTCTGAAAGTGTGG - Intergenic
1026093383 7:67319549-67319571 GAACCCTGCTACTGAAAGTGTGG + Intergenic
1026106504 7:67424870-67424892 GAACCCTGCTACTGAAAGTATGG + Intergenic
1026593691 7:71716713-71716735 CAACCCGGTTTCATAAAGTGAGG + Intergenic
1026628276 7:72015797-72015819 TAACAGTGGTTCTCAAAGTGTGG - Intronic
1026639868 7:72114743-72114765 CACCTCGGCTTCCCAAAGTGTGG - Intronic
1026692869 7:72564758-72564780 CAACAATGGTTCTGAAAGTGTGG + Intronic
1026718844 7:72813614-72813636 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1027026798 7:74858568-74858590 CACCTCAGCTTCCCAAAGTGTGG - Intergenic
1027060954 7:75085541-75085563 CACCTCAGCTTCCCAAAGTGTGG + Intergenic
1028125774 7:87111432-87111454 CAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1028249007 7:88517686-88517708 AAACCACGGTTCTCAAAGTGTGG - Intergenic
1028455467 7:91033599-91033621 CAGCCCTGCTGCTCAAAGTGTGG - Intronic
1029012968 7:97282094-97282116 CTACCCAGCTTCTTAAAGAGAGG - Intergenic
1031944556 7:127825653-127825675 CACCCCGGCCTCCCAAAGTGTGG + Intronic
1032019020 7:128396386-128396408 GCAGCCTGCTTCTCAGAGTGCGG - Intronic
1032359978 7:131246125-131246147 CAGCAGTGCTACTCAAAGTGTGG - Intronic
1032789880 7:135234355-135234377 CACCTCGGCTTCCCAAAGTGTGG + Intronic
1032848620 7:135773173-135773195 GAACCATGATACTCAAAGTGTGG + Intergenic
1034948001 7:155276514-155276536 AAAGCCCACTTCTCAAAGTGGGG + Intergenic
1035030821 7:155857663-155857685 ATAACCTGCTCCTCAAAGTGTGG + Intergenic
1035696856 8:1604392-1604414 GATCCATGTTTCTCAAAGTGTGG + Intronic
1036428154 8:8665515-8665537 CAACCTTGCTGCTCAAAGTGTGG + Intergenic
1036622162 8:10431376-10431398 CACCCCTGCTTCTCACTGGGAGG + Intergenic
1037174879 8:15935478-15935500 CAGCCCTTCTCCTCCAAGTGAGG - Intergenic
1037870481 8:22490381-22490403 CAACAGTGGTTCTCAAAGTATGG - Intronic
1037989166 8:23308385-23308407 CATCCCTGCTTCTCAAAGTGAGG - Intronic
1039078740 8:33715524-33715546 GAGCACTGGTTCTCAAAGTGTGG - Intergenic
1039495829 8:37979339-37979361 CACCTCTGCCTCCCAAAGTGCGG - Intergenic
1039844788 8:41318262-41318284 CAACTTTGCTCCTCCAAGTGTGG + Intergenic
1039896685 8:41721406-41721428 CACCTTTGCTTCCCAAAGTGCGG - Intronic
1040488513 8:47897587-47897609 AAGCAGTGCTTCTCAAAGTGTGG + Intronic
1040826005 8:51621689-51621711 CACCTCAGCCTCTCAAAGTGTGG - Intronic
1041411787 8:57564408-57564430 CATCCCTGCATTTCAAAATGAGG - Intergenic
1042642623 8:70952827-70952849 AACCACTGCTACTCAAAGTGTGG + Intergenic
1042992616 8:74657425-74657447 CAAGGCTGCTACTCAAAGAGTGG + Intronic
1043934098 8:86123390-86123412 AACTCCTGCTTCGCAAAGTGAGG + Intronic
1044124060 8:88436638-88436660 CGCCTCTGCCTCTCAAAGTGCGG - Intergenic
1044822676 8:96166004-96166026 CACCAGTGGTTCTCAAAGTGTGG + Intergenic
1045013017 8:97975005-97975027 AAACATTGGTTCTCAAAGTGTGG - Intronic
1045281904 8:100756800-100756822 CTGCCCTGCTACTCCAAGTGTGG + Intergenic
1045490758 8:102667263-102667285 GGACCCTGCTACTCAAAGTACGG - Intergenic
1045901930 8:107292132-107292154 AGAGCCTGCTTCTCAAAATGTGG - Intronic
1045950922 8:107850775-107850797 AATCCTTGCTACTCAAAGTGTGG - Intergenic
1046202049 8:110939787-110939809 GAGCCCTGGTACTCAAAGTGTGG - Intergenic
1046373769 8:113348499-113348521 CATCCCTGCTTCTCAAAGCTGGG - Intronic
1046411872 8:113855464-113855486 CAACCCAGCTTATCAATCTGTGG + Intergenic
1046578546 8:116063211-116063233 CACCCCGGCCTCCCAAAGTGCGG + Intergenic
1046757630 8:117988493-117988515 CAGCAGTGGTTCTCAAAGTGTGG - Intronic
1047316053 8:123734056-123734078 CAGCCCTGCTACTCAAAGTATGG - Intronic
1049667389 8:143852320-143852342 CTACCCTGGTTCTAAACGTGAGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050110219 9:2207719-2207741 CACCTCGGCTTCTCAAAGTACGG + Intergenic
1050457265 9:5846128-5846150 CCATCTTGCTTCACAAAGTGTGG - Intergenic
1050605353 9:7295689-7295711 CACCCCGGCTTCCCAAAGTGTGG + Intergenic
1050627906 9:7525316-7525338 TAACCCTGATTCTAAACGTGAGG - Intergenic
1051279222 9:15424681-15424703 CAACAGTGCCTCTCAAAGAGTGG - Intronic
1051361074 9:16282171-16282193 GACCCTTGCTTCTCAAAGCGTGG + Intergenic
1051439841 9:17072689-17072711 CCAGCCTGCTGCTCCAAGTGTGG - Intergenic
1051630130 9:19133212-19133234 CAGCAGTGGTTCTCAAAGTGGGG + Intronic
1052249615 9:26382258-26382280 TAGCCCTGCTACTCAAATTGTGG + Intergenic
1053254598 9:36605137-36605159 CTACCTTGCTTCCCAAAGTGTGG + Intronic
1054828708 9:69599631-69599653 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1055685141 9:78765206-78765228 GGACAGTGCTTCTCAAAGTGTGG + Intergenic
1055822227 9:80280034-80280056 CACTCCAGCTTCCCAAAGTGTGG - Intergenic
1055822289 9:80280956-80280978 CAAACTTGCTTCCCTAAGTGTGG + Intergenic
1056189638 9:84172407-84172429 CATCCTTTCTTCTCAAAGTAAGG - Intergenic
1056314688 9:85376415-85376437 CAACTCTACTTCTAATAGTGTGG - Intergenic
1056541714 9:87577168-87577190 CAACTGTGGTTCTCAAAGTGTGG + Intronic
1056802098 9:89699300-89699322 GAACCCTGCTATTCAAAGTGTGG - Intergenic
1056901881 9:90607544-90607566 CAGCCTTGCATGTCAAAGTGTGG + Intergenic
1056954228 9:91069620-91069642 CAAGCCTGCTTCTCACAAAGAGG + Intergenic
1057357475 9:94343855-94343877 CACCTCAGCTTCCCAAAGTGCGG - Intergenic
1057431828 9:95002025-95002047 CACCCCGGCCTCCCAAAGTGCGG + Intronic
1057599744 9:96447678-96447700 AAGCAGTGCTTCTCAAAGTGTGG + Intergenic
1057650276 9:96913771-96913793 CACCTCAGCTTCCCAAAGTGCGG + Intronic
1058306028 9:103441577-103441599 CACCTGTGCTCCTCAAAGTGTGG - Intergenic
1059393360 9:114014856-114014878 ACACAGTGCTTCTCAAAGTGCGG - Intronic
1059408617 9:114118076-114118098 CTACCTTGCTACTCAAAGTGTGG - Intergenic
1060278140 9:122197786-122197808 CAACCAGGCTGCTCACAGTGTGG + Intronic
1060608863 9:124942025-124942047 CGCCTCGGCTTCTCAAAGTGTGG - Intronic
1060898033 9:127231639-127231661 AGACATTGCTTCTCAAAGTGTGG + Intronic
1061761074 9:132851732-132851754 CAGCCAGGCTTCTCAGAGTGTGG - Intronic
1203661519 Un_KI270753v1:48136-48158 GAACATTGATTCTCAAAGTGTGG + Intergenic
1203672702 Un_KI270755v1:31209-31231 GAACATTGATTCTCAAAGTGTGG + Intergenic
1186215614 X:7297200-7297222 TAACCTTTCCTCTCAAAGTGTGG + Intronic
1186894524 X:13992629-13992651 GGACCTTGCTTCTCAAAATGTGG - Intergenic
1186970402 X:14835631-14835653 CATCAGTGGTTCTCAAAGTGTGG - Intergenic
1186996401 X:15128201-15128223 TAACAGTGGTTCTCAAAGTGTGG + Intergenic
1187133268 X:16523247-16523269 GAGCCTTGCTACTCAAAGTGTGG - Intergenic
1187208976 X:17210217-17210239 CACCCTTGCTTCTCAAGGTGTGG + Intergenic
1187242984 X:17530472-17530494 GACCCTTGCTACTCAAAGTGTGG + Intronic
1187453939 X:19424504-19424526 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1187528024 X:20071582-20071604 GAACACTGGTTCTCAAGGTGTGG - Intronic
1187708921 X:22034693-22034715 CAACTTTGCTTCTCAAAATGGGG + Intronic
1187807774 X:23139958-23139980 CAGGCCTGCCTCACAAAGTGTGG - Intergenic
1188290088 X:28376937-28376959 CTACCTTGCTACTCAAAGTGTGG + Intergenic
1188544289 X:31286548-31286570 CTTCCTTCCTTCTCAAAGTGTGG + Intronic
1188736117 X:33718398-33718420 GAACAGTGTTTCTCAAAGTGTGG + Intergenic
1188898300 X:35697024-35697046 GAAACTTGCTTCTCAAAGTGTGG - Intergenic
1189122531 X:38409674-38409696 GAACATTGCTTCTCAAAGTGTGG - Intronic
1189363114 X:40368648-40368670 CAACAGTGGTTCTCACAGTGTGG - Intergenic
1189724332 X:43953494-43953516 GAGACCTGCTACTCAAAGTGTGG - Intronic
1190459704 X:50660347-50660369 ATACCTTGCTACTCAAAGTGTGG - Intronic
1191669296 X:63734414-63734436 CAACACTGTTTCTTAATGTGAGG + Intronic
1192080200 X:68040430-68040452 CTACCCTGCTTCTCTAGGGGAGG - Intergenic
1192445582 X:71208700-71208722 CACCTCGGCTTCCCAAAGTGCGG - Intergenic
1192558633 X:72110126-72110148 GATCCTTGCTGCTCAAAGTGAGG + Intergenic
1195404870 X:104501810-104501832 CAACAGTGGCTCTCAAAGTGTGG + Intergenic
1195938566 X:110147749-110147771 CACCCCAGCTTCTCAAGGTTTGG + Intronic
1197789720 X:130241984-130242006 CCCCCCGGCTTCCCAAAGTGTGG - Intronic
1197804708 X:130387545-130387567 GAGCAGTGCTTCTCAAAGTGTGG - Intergenic
1198441431 X:136667244-136667266 CAACTCTGCTACTAAAAGGGAGG + Exonic
1199481910 X:148307190-148307212 CACCTCAGCCTCTCAAAGTGAGG - Intergenic
1199654434 X:149980706-149980728 GAGCCTTGCTTCTCAAAGTGTGG + Intergenic
1200839537 Y:7766598-7766620 GAATCTTGCTACTCAAAGTGTGG - Intergenic
1201569118 Y:15395601-15395623 ACACCCTGATTCTCAAAGTGAGG + Intergenic