ID: 1166264590

View in Genome Browser
Species Human (GRCh38)
Location 19:41671137-41671159
Sequence CATCAAATCCTGAAAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166264590 Original CRISPR CATCAAATCCTGAAAGTAGA GGG Intronic
904099391 1:28010716-28010738 CATCATATTCAGAAAGCAGAGGG - Intronic
904840211 1:33367739-33367761 CATCCAATCCTGAAAGTGTTGGG - Intronic
905951056 1:41951150-41951172 AATTAAATACTGAAAGAAGAAGG + Intronic
908274786 1:62458998-62459020 CATCAAATGCTTATATTAGAAGG + Intronic
908919684 1:69174297-69174319 CATCAAAAACTGAAAGGAGTGGG - Intergenic
909098357 1:71318468-71318490 CATCAAACCATGAAAATATATGG + Intergenic
909250638 1:73350341-73350363 CTTCAAATCCTGAAGGGTGATGG + Intergenic
910892523 1:92032491-92032513 CCCTGAATCCTGAAAGTAGAGGG - Exonic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
916184311 1:162115967-162115989 TGTCAAATACTCAAAGTAGAAGG + Intronic
917130724 1:171739623-171739645 CATCAGATCCTGCAGGTTGAGGG - Intronic
918652079 1:186977760-186977782 CATCAACTTCAGAAAGTACAGGG + Exonic
918837538 1:189487173-189487195 CATCAAGTCATGAAAAAAGAGGG - Intergenic
923245965 1:232132392-232132414 CATAAAAACCTGAAAGGACAGGG + Intergenic
923254787 1:232212143-232212165 CATCTTATCCTGAAAGTAATGGG - Intergenic
924312793 1:242763150-242763172 CATCAAACCCTGACAGCACATGG - Intergenic
1064675736 10:17758279-17758301 CATCAAATCATGAATGTTCAGGG - Intronic
1065145028 10:22760042-22760064 CATCAAATGTTGCAAGTATATGG + Intergenic
1065252670 10:23832415-23832437 CATAAAATCCAGAAAGGACAGGG - Intronic
1068918464 10:62458940-62458962 CTTCAAATCCTGAGAGTAGCTGG + Intronic
1069310649 10:67031808-67031830 CATAAAATCCTGAATCAAGAAGG + Intronic
1072973278 10:100036201-100036223 CATGAAATCCTCAACTTAGAAGG + Intergenic
1072995551 10:100240537-100240559 CATCTAGGCCTGAAACTAGAGGG - Intronic
1073751828 10:106537787-106537809 AATAAAAGCCTGAATGTAGAAGG - Intergenic
1075558692 10:123451932-123451954 CGTCAGATTCTGAAAGTTGATGG + Intergenic
1076502378 10:130947458-130947480 AATCTAATCCTCAAATTAGATGG - Intergenic
1079083580 11:17430197-17430219 AATGAAAGCCTGAAGGTAGAAGG - Intronic
1079707215 11:23635965-23635987 CATCAAATGCTAAAAGTGGGGGG - Intergenic
1079718485 11:23780424-23780446 AATCAAATGCTAAAACTAGAAGG - Intergenic
1079868017 11:25759302-25759324 CATCAAAGACCAAAAGTAGATGG + Intergenic
1080197960 11:29633692-29633714 AATGAAATTTTGAAAGTAGAAGG + Intergenic
1080573983 11:33581309-33581331 CAGCAAATGTTGAAAGGAGAAGG - Intronic
1080688449 11:34535377-34535399 CAGCAAATCCAGAATGTTGAAGG - Intergenic
1080822855 11:35824008-35824030 CACCCAATCCTGCAAGAAGAGGG - Intergenic
1082630439 11:55535828-55535850 GTTCCAATCCTGAAACTAGAAGG - Intergenic
1082893886 11:58169721-58169743 CATCACATCCTGGAAAAAGAGGG - Intronic
1084504804 11:69558828-69558850 CATCACATCCTGTAAGTATGAGG + Intergenic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1087740537 11:101882226-101882248 CTTCAAATCCTGAAAAAAGAAGG + Intergenic
1087772127 11:102222284-102222306 AATCAAACCCAAAAAGTAGAGGG + Intronic
1088376475 11:109146888-109146910 GACCAAAGCCTGAAAGCAGATGG + Intergenic
1090251505 11:125255034-125255056 CAGCAAACCCTGAAAGGACAGGG - Intronic
1091870377 12:3884983-3885005 TCCCAAATCCTGAATGTAGATGG - Intergenic
1092292811 12:7173989-7174011 CATCAAGTCATGAAAATAAATGG - Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1093703157 12:22245865-22245887 CATAAAAACCTGAAAGGACAGGG + Intronic
1095709954 12:45277744-45277766 GAGCAACTCCTGAAAGTAGAAGG - Intronic
1095787864 12:46130234-46130256 CATCAAAGCCTGAAAGCAGGAGG - Intergenic
1099156466 12:79182530-79182552 CAACAAAGCCTGAGAGTAAAAGG + Intronic
1099503448 12:83444292-83444314 CATAAAATCCTGAAAGCAGCAGG - Intergenic
1099977634 12:89562781-89562803 CTTTTATTCCTGAAAGTAGAGGG - Intergenic
1101532655 12:105588134-105588156 CCTCAAATCATGGAAGTAAAAGG - Intergenic
1104074819 12:125379675-125379697 CAGTTAATCCAGAAAGTAGATGG + Intronic
1108489047 13:50961263-50961285 CATCAGATCCTAAAAATAGTGGG - Intronic
1109115217 13:58373455-58373477 CATCACTTCCTGAAAGGAAAAGG + Intergenic
1109234759 13:59802038-59802060 CATTAAATCCTTAAAGTTGAAGG - Intronic
1110037405 13:70705711-70705733 CATCAAAAGCTTAAAGAAGAAGG + Intergenic
1114380148 14:22194543-22194565 TATCAAAACCTGAATGGAGATGG - Intergenic
1115686324 14:35800153-35800175 CATCAAGTACTGAGAGAAGAGGG - Intronic
1116719084 14:48469708-48469730 CATCATATCCTGCAAGTTAAAGG - Intergenic
1117136460 14:52739225-52739247 TATCGAATCCTGATGGTAGAGGG + Intronic
1118066246 14:62193754-62193776 CATCAAATCATGAAAAAACATGG - Intergenic
1118384550 14:65244908-65244930 TCTCAGATCCTGACAGTAGAGGG - Intergenic
1118856374 14:69626429-69626451 AATCAAGTCCTGCAAGAAGATGG - Intronic
1120583545 14:86283687-86283709 CATGAACTGATGAAAGTAGATGG - Intergenic
1122065136 14:99167781-99167803 CTTCAAATTCCCAAAGTAGATGG - Intergenic
1124183729 15:27502573-27502595 CATCAAATCCTAAAGGTTGAGGG + Intronic
1127682531 15:61311492-61311514 CAGCAAATGCTGAAACTAAAGGG - Intergenic
1129444484 15:75607249-75607271 CATCACATCCAGAACGTAGTAGG + Exonic
1129528267 15:76237701-76237723 CATCAAATCTCTAAACTAGAAGG + Intronic
1134008587 16:10834684-10834706 CATCAGCTCCTGAAAGTCAATGG - Intergenic
1134384338 16:13757943-13757965 CATCCCATGGTGAAAGTAGAAGG - Intergenic
1135996487 16:27253298-27253320 CATCAAATCCTACAAGTTAAAGG - Intronic
1137515257 16:49137962-49137984 CATGAAATCCTCAAAGAAAAAGG - Intergenic
1137600170 16:49751034-49751056 CATCAAATCCTGAAATCAGAAGG + Intronic
1137690114 16:50420330-50420352 CAGCAAATCCTGGAAGGAGTAGG - Intergenic
1138555064 16:57766160-57766182 CAACAAAGGCTGGAAGTAGATGG - Intronic
1139106160 16:63829531-63829553 CATCAATTCCTCAAAGCAGTGGG - Intergenic
1140591012 16:76352720-76352742 CATCACATCCTGAAAAATGAAGG + Intronic
1140995577 16:80256069-80256091 GATCAAATTCTGAAACTAGAAGG + Intergenic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1144838919 17:18173767-18173789 CATCAATTCCTGGGAGTAGGAGG - Exonic
1147544681 17:41392060-41392082 CTTCAAATCCTGCAAGGACAAGG + Intronic
1147621266 17:41869097-41869119 AATCTTATCCTGAATGTAGATGG - Exonic
1147768070 17:42850068-42850090 CACCAGATCCTGCAAGAAGAAGG - Exonic
1148089988 17:45017795-45017817 CATCAAATCCTGAATCCAGGTGG - Intergenic
1148955339 17:51349172-51349194 CATCCAAACCTGGAAGTAGGAGG - Intergenic
1148983782 17:51602530-51602552 CATCAGATCCTGCAAGCTGAAGG - Intergenic
1153031973 18:722461-722483 AATTATATCCTGAAAATAGAGGG + Exonic
1153328974 18:3852986-3853008 TATTAAATCCTGAAACTAGTTGG + Intronic
1155293717 18:24366292-24366314 CATAAAAACCTGAAAGGACAGGG - Intronic
1156953298 18:42931295-42931317 TATCAAATCCTTAAACTAAATGG + Intronic
1158133010 18:54173914-54173936 CATCATAACATGAAACTAGATGG - Intronic
1158177865 18:54677835-54677857 CTCTAAATCCAGAAAGTAGATGG - Intergenic
1160134757 18:76262701-76262723 CATAACATCGTGAAAGGAGAGGG - Intergenic
1161944118 19:7423995-7424017 CATAAAAACCTCAAAGTGGAGGG - Intronic
1164504425 19:28847629-28847651 CAGCAAAGCCTGGAAGAAGAGGG - Intergenic
1164886321 19:31781767-31781789 CACCAAAGCCTGGAAGGAGAAGG + Intergenic
1165001724 19:32769174-32769196 CATAAAATCCTAAAAGAAAAAGG - Intronic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1166273534 19:41734310-41734332 TGTCAAATCCTGAGAGTAGAGGG - Intronic
1166278602 19:41774154-41774176 TGTCAAATCCTGAGAGTAGAGGG - Intergenic
1166398012 19:42456712-42456734 TGTCAAATCCTGAGAGTAGAGGG + Intergenic
1166413851 19:42577507-42577529 TGTCAAATCCTGAAAGTAGAGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166450730 19:42898410-42898432 TGTCAAATCCTGAAAGTAAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
1167501262 19:49850068-49850090 AGACAAATCCTGAAAGTAGAAGG - Intergenic
925594264 2:5539730-5539752 TATAAAATCCTTAAACTAGAAGG - Intergenic
927870954 2:26623406-26623428 CAAGAAATCCTAAAAGTAGGTGG - Intronic
930995594 2:57713579-57713601 CATCAAATCATGAGAGTATCAGG + Intergenic
937124857 2:119467608-119467630 AATCAATTCCTGAAGGTAGAAGG - Intronic
937888751 2:126918880-126918902 CATCAGATCCTGCAAGTTAAAGG + Intergenic
937988784 2:127650842-127650864 GATAAAATCCAGAAGGTAGAAGG - Exonic
941692086 2:168511204-168511226 AATTAAATCATGAAAGGAGAAGG - Intronic
943019718 2:182557876-182557898 CATCAACTACTGAAAGTAGCTGG + Intergenic
943120660 2:183731070-183731092 TAACAAATCCTGAAATAAGATGG - Intergenic
944880597 2:204008958-204008980 AAAGAAATCCTGAAAGTTGAAGG - Intergenic
945426162 2:209705860-209705882 CAGAAAATCCAGAATGTAGATGG + Intronic
945629966 2:212262174-212262196 ATTCAAATCATAAAAGTAGATGG + Intronic
945728594 2:213504425-213504447 GTTAAAAACCTGAAAGTAGAAGG + Intronic
946066032 2:216987972-216987994 CGTCAAATCGTGGAAGAAGATGG + Intergenic
946079757 2:217107286-217107308 CATCATGTCTAGAAAGTAGAAGG + Intergenic
946941906 2:224777857-224777879 AATCAAAGCCTGAAAGTAATTGG - Intronic
947144244 2:227050086-227050108 CATCAATTCCTGAAAATCCAGGG + Exonic
947318192 2:228886401-228886423 AATCAACACCTGAAAGAAGAGGG + Intronic
1168988838 20:2077026-2077048 TATCAAAACATGAAAATAGATGG + Intergenic
1170083764 20:12506300-12506322 CATCAAATTTTCAAAGTAGAGGG + Intergenic
1170803783 20:19612156-19612178 CATCAAATCTTCTAAGTAAATGG + Intronic
1170874280 20:20235742-20235764 CATCAAATGCTGTAAGTTGGGGG - Intronic
1171990135 20:31689653-31689675 CAGGAACTCCTGAAAGTAGATGG + Intronic
1172655388 20:36533708-36533730 CATCAACTCCTAACAGTAGAGGG + Intergenic
1176984289 21:15418501-15418523 CATCAAAGGCTGAGAGTAAATGG - Intergenic
1177016264 21:15791914-15791936 CAACAATTCCTAAAAGCAGAAGG - Intronic
1181817379 22:25448585-25448607 CATCAAATCCTGGAGGCAGCTGG - Intergenic
1183076649 22:35431603-35431625 CATCAAATCTTAGAATTAGATGG + Intergenic
1184569394 22:45312245-45312267 CATCAAATCTCGCAAGTTGAGGG + Intronic
950685566 3:14616270-14616292 CTCCAAATCATGAAAATAGAAGG + Intergenic
951405243 3:22289273-22289295 CATCAACTCCTGAATCTAGGTGG + Intronic
951435696 3:22661103-22661125 CATCAAGTCATGAAAGGAGATGG + Intergenic
952268849 3:31813143-31813165 CATCAAAGAATGAAAGTAGCTGG + Intronic
952714790 3:36469709-36469731 CATCCAAACCTGAAAGTAATTGG - Intronic
953004697 3:38967493-38967515 AATGAACTCCTGAAAATAGAGGG - Intergenic
959197780 3:103208033-103208055 CCACAAATCCTGAAAGTAGTAGG - Intergenic
961227431 3:125264321-125264343 CATCAGATCCTGCAAGTTAAGGG - Intronic
962777335 3:138674526-138674548 CGACAAATCCTGAAGGGAGAAGG + Intronic
963429931 3:145187498-145187520 CACCAAGTATTGAAAGTAGATGG - Intergenic
964650759 3:159008897-159008919 CATCAGATTTTGAAAATAGAGGG + Intronic
964900852 3:161657163-161657185 CATCACATCCTGATTATAGAAGG - Intergenic
965298974 3:166986217-166986239 TATAAAATCCCCAAAGTAGAAGG + Intergenic
965542488 3:169884010-169884032 CATACAATCCTGAAAATCGAAGG + Intergenic
965844172 3:172942342-172942364 CATAAAATGTTGAAAGTAAAAGG + Intronic
966695059 3:182781026-182781048 CCTCAAATTCTGAAACTAAAGGG - Intergenic
968768205 4:2485972-2485994 CATCAATTCCAGAAACTAGCGGG - Intronic
970263647 4:14256712-14256734 CATCAAGGCATTAAAGTAGATGG + Intergenic
971718954 4:30219678-30219700 AATCAAATTCTGAAAGTTCAAGG - Intergenic
974168902 4:58240619-58240641 CTTCAAATCCTTTAAGTAAAAGG - Intergenic
975303334 4:72817816-72817838 CTTCCAATTCTGAAAGCAGATGG - Intergenic
976133336 4:81908308-81908330 CATCAAACCATGAAACTACATGG + Intronic
976607801 4:86998855-86998877 CTTGAGATACTGAAAGTAGAGGG - Intronic
978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG + Intergenic
978834355 4:113130602-113130624 CATTAAAACCTCAAAGTACATGG - Intronic
978854452 4:113378144-113378166 AATGAAATCCTGAAAGAGGATGG + Intronic
980422532 4:132582791-132582813 TATGAAAACCTGAAGGTAGAGGG + Intergenic
981236232 4:142419001-142419023 CATCAAGTCCTGTAAGTTGTAGG - Intronic
984413978 4:179433607-179433629 CATGAAATCTTGAAAGATGAAGG - Intergenic
984788938 4:183596069-183596091 GATCAAATGGAGAAAGTAGAGGG + Intergenic
985922664 5:2991402-2991424 CATCAAAAACTGAAAGTGCATGG - Intergenic
987426492 5:17778852-17778874 CATAAAAACCTGAACGAAGATGG - Intergenic
987568254 5:19621925-19621947 CATCAACTCTGGAAAGCAGAAGG - Intronic
988466427 5:31496571-31496593 CATCAAGGGCTGAAAGTAGCTGG - Intronic
989735804 5:44703747-44703769 CATCAAATCCTAAAATTTCAAGG + Intergenic
991947209 5:71910808-71910830 CATCAAAACCTTAAAGTACGAGG + Intergenic
991957732 5:72012588-72012610 CCTCAAATCTTGAAATTAGGAGG - Intergenic
993039755 5:82800658-82800680 CATGAAATCCTGAGAGTTAATGG + Intergenic
993179751 5:84537254-84537276 TATCAAATCCTGCATGTATAAGG - Intergenic
996115554 5:119614275-119614297 CATCAATCCATGAAAGTAAATGG - Intronic
996673389 5:126146688-126146710 TAGCAAATCCTGACAGTAAATGG + Intergenic
1000268302 5:159658812-159658834 CATCTAGTCCTGAAAGCTGAGGG - Intergenic
1000702781 5:164473859-164473881 ATTCAAATCCAGACAGTAGAAGG - Intergenic
1000863028 5:166479205-166479227 CTCCAAATCCTGAAAGGAGGAGG + Intergenic
1000944827 5:167408219-167408241 TTTCAACTCCTAAAAGTAGAAGG + Intronic
1006011043 6:31043159-31043181 CACCATTTCCTAAAAGTAGAAGG - Intergenic
1007937992 6:45750831-45750853 CATCAGATCCCGCAAGTTGAGGG - Intergenic
1008410991 6:51179632-51179654 CATCAAATATTGAAAGAAGATGG - Intergenic
1008634105 6:53392406-53392428 CATCAGATCCTGCAGGTGGATGG + Intergenic
1008970366 6:57360347-57360369 CATTAAATGCTGAAAATAAAAGG - Intronic
1009159335 6:60262167-60262189 CATTAAATGCTGAAAATAAAAGG - Intergenic
1011107180 6:83795440-83795462 GACCAAATCCTTAAAGTAAATGG + Intergenic
1012029518 6:94040139-94040161 CAGGGAATCATGAAAGTAGAAGG - Intergenic
1012480253 6:99659102-99659124 AATCAAAAACTAAAAGTAGAAGG + Intergenic
1013577160 6:111494975-111494997 CATCAAATGATCAATGTAGAGGG - Intergenic
1013791080 6:113837234-113837256 GAACAAATACTAAAAGTAGAAGG + Intergenic
1014231617 6:118909735-118909757 CCCCAAATCCTAAAATTAGAGGG - Intronic
1014732727 6:125052621-125052643 CATCAAATCCTAAAGTCAGATGG - Intronic
1014759974 6:125345688-125345710 CATCAAATGTTGAAAATAGAAGG + Intergenic
1015083482 6:129257672-129257694 CATCTAATTCTGAAATTAAAAGG + Intronic
1017531202 6:155293991-155294013 CATGAAATCCAGGAAGCAGAGGG - Intronic
1018429248 6:163710392-163710414 AATCAAATATTGAAAGGAGAGGG - Intergenic
1018533704 6:164796127-164796149 CATCAAAACCTGCAAGTACATGG + Intergenic
1019850428 7:3550801-3550823 TATCAAAACATGAAAATAGAAGG - Intronic
1020546094 7:9533410-9533432 CATCAAATGGTGAAAATACATGG - Intergenic
1021673444 7:23056710-23056732 CATCAAGTCATGAAAATATACGG + Intergenic
1024108829 7:46123705-46123727 GTTGAAATGCTGAAAGTAGAAGG - Intergenic
1026030960 7:66793634-66793656 CATAAAATACTTGAAGTAGAAGG + Intronic
1026731985 7:72919954-72919976 GATCAAATCCTGAAGGCAGCTGG - Intronic
1027111984 7:75447405-75447427 GATCAAATCCTGAAGGCAGCTGG + Intronic
1027284214 7:76631936-76631958 GATCAAATCCTGAAGGCAGCTGG + Intergenic
1027766992 7:82356507-82356529 TATCTAATTCTGAAAGTATAAGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028381681 7:90207254-90207276 CATCAAATGCTGAAAGCACATGG + Intronic
1028847732 7:95501200-95501222 AAGCAAATCCTGACAGTAGGAGG + Intronic
1028847982 7:95504193-95504215 AAGCAAATCCTGACAGTAGGAGG + Intronic
1035911094 8:3567208-3567230 CACCAAATGGTGAAAGTACATGG + Intronic
1037268867 8:17102791-17102813 TATCAAATCCTCAAAGAAGTTGG + Intronic
1037474102 8:19239249-19239271 TGTCAAATCCTGAATGAAGAGGG + Intergenic
1037763052 8:21754927-21754949 TATCAAATCATGAAAGGACACGG + Intronic
1038280776 8:26162376-26162398 CATCAAACCCTGCAAGTTAAAGG + Intergenic
1041190891 8:55353030-55353052 CAGGAAATCTGGAAAGTAGATGG + Intronic
1042003243 8:64150373-64150395 CATCAAATCCTTGAAGTCTAGGG - Intergenic
1044455736 8:92391124-92391146 CATCTATTTCTGAAAGTAAAGGG - Intergenic
1044489399 8:92794162-92794184 AATCAAATGCTGAAAGTGTAAGG + Intergenic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1047719075 8:127621849-127621871 CAACAAGTTCTGAAAGTAGATGG + Intergenic
1048658400 8:136569666-136569688 CTTCACATCCTGAAAGTATATGG - Intergenic
1049114483 8:140674251-140674273 CCACAAATCCTGCAAGCAGAAGG + Intronic
1050132156 9:2424075-2424097 CATGAAAGACTAAAAGTAGATGG + Intergenic
1050290555 9:4149673-4149695 CAAAAATTCCTGAAAGTAAAAGG - Intronic
1051709551 9:19917171-19917193 AAACAAAACCTGAAAGTAGAGGG - Intergenic
1051804147 9:20972900-20972922 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804156 9:20973002-20973024 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804174 9:20973211-20973233 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804182 9:20973316-20973338 CAGCAGATGCTGAAAGAAGACGG - Intronic
1055227350 9:74015239-74015261 CATAAAATTCTGAAACTAGCCGG + Intergenic
1056331545 9:85525221-85525243 CATCAAATCCTGAGAGTCATTGG + Intergenic
1056412134 9:86339876-86339898 CATCAAATGCCAAAAGTATAGGG + Intronic
1057006477 9:91565348-91565370 CATCAAATCCTGCAGGCTGAGGG + Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057696415 9:97326001-97326023 CATCACATTCTGAAAGAAAAAGG + Intronic
1057919305 9:99083416-99083438 CAGCAAATTCTGTAAGTGGATGG + Intergenic
1060168016 9:121436054-121436076 AATAATATCCTGAAAGTTGAAGG - Intergenic
1186368331 X:8919310-8919332 AATCAATTCCTTATAGTAGAGGG + Intergenic
1187363682 X:18649924-18649946 CATCAAATGCTCAAAGTGGAGGG - Intronic
1188663192 X:32786502-32786524 CATTAAATAATTAAAGTAGAAGG - Intronic
1189217540 X:39339525-39339547 CAGCAACTCCATAAAGTAGATGG + Intergenic
1190950125 X:55135377-55135399 CACCCACTCCTGAAAGTGGATGG - Intronic
1193321129 X:80122729-80122751 CATGAAATCCTGTTGGTAGAAGG - Intergenic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1195196810 X:102505098-102505120 CTTCCAATTCTGAAAGAAGATGG - Intergenic
1195234144 X:102880173-102880195 GATCAAATCCAGACACTAGAAGG + Intergenic
1195505115 X:105647428-105647450 CATCTAAGCCTGAGAGTACAGGG - Intronic
1199061334 X:143358655-143358677 CATCAAATTTTGAAACTAGAAGG + Intergenic
1199200175 X:145078042-145078064 AAACAAATCCTGAAATTTGATGG - Intergenic
1200920816 Y:8611319-8611341 CATCAAAACATGAAAGTATTTGG - Intergenic