ID: 1166267026

View in Genome Browser
Species Human (GRCh38)
Location 19:41690687-41690709
Sequence TCTCCAGGGACCCTCGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166267013_1166267026 3 Left 1166267013 19:41690661-41690683 CCAGAGACCACAGCCAGGAGCCC 0: 1
1: 1
2: 4
3: 45
4: 471
Right 1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
1166267011_1166267026 24 Left 1166267011 19:41690640-41690662 CCTTGGGCTGGTTAGAGGTCTCC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
1166267014_1166267026 -4 Left 1166267014 19:41690668-41690690 CCACAGCCAGGAGCCCCCATCTC 0: 1
1: 1
2: 7
3: 87
4: 422
Right 1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
1166267017_1166267026 -10 Left 1166267017 19:41690674-41690696 CCAGGAGCCCCCATCTCCAGGGA 0: 1
1: 0
2: 5
3: 62
4: 478
Right 1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166267026 Original CRISPR TCTCCAGGGACCCTCGGGGG TGG Intronic
900174001 1:1284084-1284106 CCTCCAGGTACCGTGGGGGGGGG + Exonic
900296882 1:1956334-1956356 TCTCCTGGGGCCCTCGGGCCTGG + Intronic
900585699 1:3431309-3431331 CCTCCAGGGCCCCTGGGGGTGGG - Intronic
901642726 1:10701227-10701249 TCTCCAGGGACCCGGGCAGGAGG - Intronic
901972301 1:12917881-12917903 TCATCAGGGACCCTAGAGGGAGG - Exonic
902012878 1:13283881-13283903 TCATCAGGGACCCTAGAGGGAGG + Exonic
902479895 1:16706230-16706252 TGTCGAGGGACCATGGGGGGTGG - Intergenic
903057409 1:20645750-20645772 TCTCCAGGGGCACTAGAGGGTGG + Intronic
903919341 1:26788222-26788244 TCTGCAGGCTCCCTCGGGAGTGG + Exonic
904940426 1:34162236-34162258 TCTCCAGGGAGGCTGGGGTGGGG + Intronic
904973544 1:34437853-34437875 TCTCCAAGGACCCTCGCGTAGGG - Intergenic
912194376 1:107380095-107380117 TCTGCAGTGACCTTCAGGGGAGG + Intronic
913703707 1:121397529-121397551 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
913980059 1:143499238-143499260 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
914074407 1:144324723-144324745 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
914104769 1:144641723-144641745 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
919785450 1:201255269-201255291 TCCCCAGGGTCCCGCAGGGGCGG - Intergenic
919817206 1:201449035-201449057 TCTCCAGGGAGCCAGGGGTGAGG - Intergenic
1063078811 10:2745070-2745092 GCTCCAGGGACCCTCTTGGAAGG - Intergenic
1063929722 10:11017659-11017681 TTGCCAGGGACCCCCGGGCGGGG + Intronic
1065105482 10:22379557-22379579 TGTCCAGGCACACTCGTGGGAGG - Intronic
1065188717 10:23192379-23192401 ACTCCAGGGAGGCCCGGGGGCGG + Exonic
1066483569 10:35822409-35822431 TCTCCAGCAGCCCTCTGGGGAGG + Intergenic
1067234504 10:44436552-44436574 TCTCCAGGGACCCTTAGGCTGGG + Intergenic
1068620394 10:59176154-59176176 TATCCTGGGACCTTCAGGGGAGG + Intergenic
1068711674 10:60141605-60141627 TCTCCAGGTATTCTCGGGGGCGG - Intronic
1071008504 10:80911027-80911049 TCTCCTTGGACCCTCCAGGGAGG + Intergenic
1075597578 10:123743264-123743286 CCTCCTGGGACCCACGTGGGAGG + Intronic
1076680799 10:132170269-132170291 CCTCCAGGGTCCCCCGAGGGCGG + Intronic
1076765618 10:132631357-132631379 TCTCCAGGTCCCTTCGGGGCTGG - Intronic
1076903021 10:133349050-133349072 TCTTCAGGGCCCTGCGGGGGAGG - Intronic
1077220019 11:1411655-1411677 TGGCCAGGGCCCCTCGAGGGAGG + Intronic
1077412457 11:2410039-2410061 TCCGCAGGGCCCCTCGGGGCAGG - Intronic
1077487640 11:2846382-2846404 CCTCCAGGTACCCACGGTGGGGG + Intronic
1077554479 11:3219288-3219310 CCTCCAGAGACCCTCCGGGGAGG - Intergenic
1077600408 11:3570779-3570801 ACACCAGGGCCCATCGGGGGTGG + Intergenic
1078542556 11:12223511-12223533 CCTCCTGGGACCCTGGTGGGTGG + Intronic
1079550606 11:21692710-21692732 TCACCAGGGCCTGTCGGGGGTGG - Intergenic
1080605394 11:33860988-33861010 TCTCCAGGGTCACTCAGGGCTGG - Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1082834329 11:57640446-57640468 TATCCAGGGACCCTTGGTTGGGG - Intergenic
1083237621 11:61361805-61361827 TCTCCTAGGAACCTCGGGAGCGG - Exonic
1084256321 11:67945394-67945416 ACACCAGGGCCCATCGGGGGTGG + Intergenic
1084515662 11:69636963-69636985 GCTCCAGGGACCCCAGGGGAAGG + Intergenic
1084516158 11:69638990-69639012 CGTCCAGGAACCCGCGGGGGAGG - Intergenic
1086722192 11:90134579-90134601 TCCCCAGGGGCCCTCGATGGGGG - Exonic
1087951673 11:104228417-104228439 TTTCCAGGGACCCTCAGCTGTGG - Intergenic
1088800654 11:113303884-113303906 TATCCATGGACCCTTGGGAGGGG + Intergenic
1089769909 11:120795353-120795375 CCTCCAGGGTCCCCCGGGGCTGG - Intronic
1090892198 11:130933709-130933731 TTTCCAGGGTCCCTCAGCGGTGG - Intergenic
1091718184 12:2794731-2794753 TCTCCTGGGACCCTCGGACTCGG - Intergenic
1094493699 12:30976701-30976723 TCTCCTGGGTCCCTGGGAGGAGG - Intronic
1096240978 12:49960262-49960284 TCTCCCGGGATCCTGGGGGTGGG + Intergenic
1102983146 12:117258344-117258366 TGTCCAGTTACCCTCGGGGGTGG + Intronic
1103484527 12:121273907-121273929 ACTCCAGGGAACCTTGGGGGCGG - Intronic
1118349553 14:64963828-64963850 TCTCCAGGGGCCCTGGGTGTGGG - Intronic
1118472469 14:66087601-66087623 TCTCCAAGGACCCTAGGGACAGG + Intergenic
1121734138 14:96206091-96206113 TCTCCAGAGAACCTCGGGCAGGG - Intronic
1122130950 14:99604306-99604328 TCCCCAGTCGCCCTCGGGGGCGG - Intergenic
1123393383 15:19899779-19899801 GCTCCAGGGTCCCATGGGGGTGG + Intergenic
1123948329 15:25249658-25249680 TCTCCAGGTGCCCCCGGGGAGGG + Intergenic
1127286549 15:57538508-57538530 TCTCCAGGGGCCCTCCAGGGAGG + Intronic
1132646580 16:1002041-1002063 TTTCCAGGGAGCCCCAGGGGTGG + Intergenic
1132756088 16:1486169-1486191 GCACGAGGGACCCTCCGGGGGGG + Exonic
1133131053 16:3676350-3676372 TCTCCTGGTTCCCTCGGGCGGGG + Intronic
1134179287 16:12034553-12034575 TCCACAGGGTCCCTCAGGGGTGG + Intronic
1135306026 16:21368340-21368362 TCCACAGGGTCCCTCGGGGGTGG + Intergenic
1135801918 16:25505413-25505435 TCACCAGGGACTGTCAGGGGAGG - Intergenic
1136302762 16:29347490-29347512 TCCACAGGGTCCCTCGAGGGTGG + Intergenic
1136699377 16:32117153-32117175 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1136768270 16:32810781-32810803 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
1136799869 16:33060324-33060346 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1136957771 16:34804337-34804359 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1139471734 16:67181542-67181564 TCTCCAGGTAGTCTCTGGGGAGG - Intronic
1139532267 16:67548192-67548214 CCTCCAGGGACCCCTGGGGCAGG - Intergenic
1141643016 16:85352462-85352484 TCTCCAGGGCCCCCTGGGAGTGG + Intergenic
1142224412 16:88870595-88870617 CCTGCAGGGACCCTCGTGGCTGG + Intergenic
1142262786 16:89050545-89050567 TCCCCTGGGGCCCTCGAGGGAGG + Intergenic
1203070662 16_KI270728v1_random:1072797-1072819 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
1143186574 17:5013812-5013834 TCTCCAGGGACCACCAGGGAAGG - Intronic
1143186717 17:5014402-5014424 TCTCCAGGGACCACCAGGGAAGG - Intronic
1143679972 17:8469131-8469153 TCTCCAGGGACACTCGCGGTGGG + Intronic
1145007237 17:19344652-19344674 TTGCCAGCGACCCTCGGGGCCGG - Intronic
1146436302 17:32851661-32851683 TTTCCATGGACCCAGGGGGGTGG + Intronic
1146739077 17:35265420-35265442 TCACCAGGGACCCAGGGGGGAGG - Exonic
1147637315 17:41972040-41972062 TCCCCAGGGACACATGGGGGAGG + Intronic
1147740439 17:42668238-42668260 GCTGCAGGGCCTCTCGGGGGAGG + Exonic
1150281634 17:63932419-63932441 TCTCCGGGGACCCTGGGGGAGGG + Intergenic
1151564527 17:74890374-74890396 CCTCCAGCTACCCTCTGGGGAGG - Intronic
1152178817 17:78805159-78805181 TCTGCAGGAACCCTGGGAGGTGG - Intronic
1152525802 17:80887641-80887663 GCTCCTGGCACCCTCTGGGGTGG + Intronic
1152659169 17:81534538-81534560 TCTCCCAGGACCCCTGGGGGAGG - Intronic
1154518185 18:15197299-15197321 GCTCCAGGGTCCCGTGGGGGCGG - Intergenic
1155056549 18:22188841-22188863 CCTCCAGGGATCCTGGGGGCAGG + Intronic
1156088805 18:33440745-33440767 TGTCCAGGCAACCGCGGGGGCGG + Intronic
1158425966 18:57339934-57339956 TCTCCAGGGACCCCAGGGAATGG + Intergenic
1160912845 19:1482828-1482850 GCTCCAGAGCCCCTGGGGGGAGG + Intronic
1160978467 19:1805849-1805871 TCGCTGGGGACCCTGGGGGGTGG - Intronic
1161401440 19:4067496-4067518 GCGCCAGGGACCCCGGGGGGTGG + Intergenic
1161590700 19:5127922-5127944 TCCCCAGGGACCCTCTGAGCAGG + Intronic
1161663313 19:5560394-5560416 TCTCCAGGCACCATGGGCGGAGG - Intergenic
1163148832 19:15399496-15399518 TCTCGATGGACCCTCTGGAGTGG - Intronic
1164748230 19:30631421-30631443 TGTCCATGGACCCTGGTGGGAGG - Intronic
1164771350 19:30811799-30811821 TCTCCAGGGACCCTGGCTGATGG - Intergenic
1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG + Intronic
1166915610 19:46194156-46194178 TTTCCAGGGACCCCCAGTGGGGG - Intergenic
1167559035 19:50214459-50214481 TTTCCTGGGACCCTTGGGGCAGG + Intronic
1167636767 19:50659955-50659977 TCTGCGGGGAACCTCGTGGGAGG - Intronic
1168639273 19:58020023-58020045 TCTTCAGGGACTCCCGGGTGGGG + Intergenic
1202680086 1_KI270712v1_random:2232-2254 GCTCCAGGGTCCCGTGGGGGTGG - Intergenic
1202713932 1_KI270714v1_random:32136-32158 TGTCGAGGGACCATGGGGGGTGG - Intergenic
925771942 2:7290507-7290529 TGTCCAGGGACCCTCAAGGAAGG + Intergenic
926079842 2:9976286-9976308 TCTCAAGTGACCCTCGGCGGGGG + Intronic
927666337 2:25035556-25035578 TCTCCAGGGACCATAGGGGCTGG + Intergenic
931792247 2:65674514-65674536 TCTCCAGGGAACCTTGGAAGTGG + Intergenic
933619117 2:84516543-84516565 TCTCTGGAGACCCTCGGCGGTGG + Exonic
933748687 2:85589233-85589255 GCTCCAGGGACCCTGGAAGGAGG - Intronic
937228558 2:120383785-120383807 TCTCCTGTGGCCCTGGGGGGTGG + Intergenic
937890392 2:126934085-126934107 CCTCCAGGGACCCCAGGAGGTGG + Intergenic
938518091 2:132037542-132037564 GCTCCAGGGTCCCTTGGGGGAGG - Intergenic
938587216 2:132702797-132702819 TCTCCCAGGAACCTCGGGGTAGG + Intronic
944951212 2:204751389-204751411 TCTCCTGGGGCCCTCTGGGCAGG + Intronic
948355434 2:237373708-237373730 TCTCCCGGGTCACTCGGGTGGGG - Intronic
948463270 2:238140338-238140360 TCTCCGGGGTCCCTGGGGGGTGG + Intronic
949043040 2:241858149-241858171 TCTCCAGGATCCCTCCTGGGTGG - Intronic
1169266792 20:4172051-4172073 GCTCCAGGGAGCCTGGGGTGAGG + Intronic
1169531160 20:6486576-6486598 GCTCCAGGTGCCCTCTGGGGTGG + Intergenic
1169631462 20:7637342-7637364 TCTCCAGGGACACATGGGGTGGG + Intergenic
1170808888 20:19658157-19658179 TCTCCAGGGCCCCTCTGCTGAGG - Intronic
1172064074 20:32207329-32207351 TCTCCAGGGAGCCTAGGGGTCGG + Intronic
1172146772 20:32762801-32762823 TCTCCAGGGACCTCCCGAGGAGG + Intronic
1173268554 20:41510122-41510144 TCTCCCGGGGCCCTCTGGGTGGG - Intronic
1173881018 20:46412336-46412358 TCTCCTGGGACCCTGGGGGGTGG - Intronic
1173948167 20:46968163-46968185 TGTCCTGTGACCCTAGGGGGAGG + Intronic
1175401324 20:58701358-58701380 TCTCCAGGGTGCCCTGGGGGGGG + Intronic
1175676039 20:60947761-60947783 TCACCTGGGACCCTCATGGGAGG + Intergenic
1175760671 20:61560624-61560646 TCGCCAGGGCCCCGCGGGTGGGG - Intronic
1176236137 20:64054399-64054421 CCTCCAGGGACCCTGGGGACCGG - Intronic
1176379571 21:6105353-6105375 CCTCCTGGGACCCACGGGTGTGG - Intergenic
1177107531 21:16978643-16978665 TCTCCAGGCGCCCTCTTGGGTGG + Intergenic
1177323523 21:19553505-19553527 TCTCCATGGAACCTCTGGGTTGG + Intergenic
1179642889 21:42758854-42758876 TCTCCAGGGACTTTCTGGGAGGG + Intronic
1179658937 21:42862577-42862599 TGGCCAGGGACCCTCTGGGGAGG - Intronic
1179743903 21:43432884-43432906 CCTCCTGGGACCCACGGGTGTGG + Intergenic
1181029702 22:20143811-20143833 TCTCCAGGGCCCCTCTTGGCTGG + Intronic
1181521238 22:23449894-23449916 CCTCCAGCGTCCCTCGGGGGAGG - Intergenic
1181668093 22:24412204-24412226 TCTCCAGTGGCCCTCTGGGTAGG - Intronic
1182667497 22:31970528-31970550 GTTCCAGGGACCCGCTGGGGCGG - Intergenic
1183282140 22:36937668-36937690 ACTCCAGGGACCCTGGAGGTGGG - Exonic
1184649603 22:45913508-45913530 TCTCCAGGCCCCCCCAGGGGTGG - Intergenic
950260819 3:11542562-11542584 TCTCCAGGGACCCAGGTGAGAGG - Intronic
952478000 3:33731205-33731227 TCACCATGGTCCCTCTGGGGAGG + Intergenic
953605350 3:44410057-44410079 TCTCCAGGGAAGCTGGGGGTGGG - Intergenic
956679592 3:71765697-71765719 TATCCAGGGACCCACGTTGGTGG + Intergenic
956799506 3:72744116-72744138 TTTCCAGGGGCCCTCTGGGCTGG + Intergenic
961306033 3:125959510-125959532 TCAGCAGGGACCTTCGGGGCTGG - Intergenic
961742118 3:129039544-129039566 TCTCCAGGGTCCTCAGGGGGAGG + Intronic
962835327 3:139184545-139184567 TCTGCTGGAACCCTAGGGGGAGG + Intronic
963335518 3:143971011-143971033 TCCTCAGGGACCCTCAGGGGCGG + Intergenic
963411966 3:144939935-144939957 TCTCCAAGGGCCTTCAGGGGAGG - Intergenic
966168616 3:177051276-177051298 TCTCCTGGGACCTTCCTGGGGGG + Intronic
966402727 3:179563387-179563409 TCTCTAGGGAGCCTCGGGGCTGG + Intronic
966913427 3:184571680-184571702 TCTCCAGGGACCCAGGGAGGAGG - Intronic
966990272 3:185222752-185222774 GGTCCAGGGACTCTCGGGTGTGG - Intronic
967847945 3:194058605-194058627 TCTCCAGGGCCCTGCGGGGTGGG + Intergenic
967930328 3:194686253-194686275 TCTCCAGCACCCCTCGGAGGTGG + Intergenic
968472070 4:786853-786875 CCTCCAGGGACCCCCCGGGGTGG - Intronic
981260563 4:142713713-142713735 ACTCCAGGGACACTCAAGGGTGG - Intronic
985537581 5:473603-473625 TGTCCCGGGACCCCCGGCGGGGG - Intronic
986185552 5:5433192-5433214 ACACCAGGGACCCTTGGGGCAGG - Intronic
994780494 5:104083640-104083662 ACACCAGGGACTGTCGGGGGTGG + Intergenic
995031830 5:107490003-107490025 TCTCCAGGGTCCCTCAGCTGGGG + Intronic
1002054211 5:176589478-176589500 GCACCAGGGACCCTGGGGGCTGG - Intronic
1002059934 5:176620226-176620248 TATTCATGGACTCTCGGGGGCGG + Exonic
1002065505 5:176649768-176649790 CCTCCAGGGCCCCGCGGGGCCGG + Intronic
1002578885 5:180195193-180195215 GCTCCAGGGACGCTGGCGGGAGG - Intronic
1006432119 6:34003431-34003453 TCTCCAGAGTCCCTTGAGGGGGG + Intergenic
1006637153 6:35468935-35468957 TCTCCAGGAACCTTCGAGAGAGG - Exonic
1006683046 6:35811011-35811033 TCTCCTGGGACCCTCGCTAGTGG + Intronic
1007072080 6:39045302-39045324 TCTCCAGTGACCCTAGCGTGGGG - Intergenic
1008979891 6:57471151-57471173 TCTCCAGGGACCATCTGGTTTGG + Intronic
1009167995 6:60364073-60364095 TCTCCAGGGACCATCTGGTTTGG + Intergenic
1013645282 6:112132526-112132548 TATCCATGAACCCTTGGGGGTGG + Intronic
1016410242 6:143775240-143775262 CTACCAGGGAACCTCGGGGGAGG + Intronic
1019155261 6:170034273-170034295 TCTCCAGGAGCCCTCGGGCAGGG - Intergenic
1019333589 7:472101-472123 TCCCCAGGGACTCCCGGGGCAGG + Intergenic
1019746568 7:2703539-2703561 TCACCAGCGACCCTCAGGGAAGG - Intronic
1019899301 7:4007418-4007440 TCTACAGGAAGCCTCGGGGCAGG + Intronic
1020138455 7:5599248-5599270 GCCCCAGGGAACCTGGGGGGTGG + Intronic
1024055706 7:45658824-45658846 CTTCCAGGGCCCCTCCGGGGGGG + Intronic
1024323090 7:48089036-48089058 CCTCCCGGGACCTTCGCGGGAGG + Intronic
1025481991 7:60993136-60993158 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1025562116 7:62381228-62381250 GCTCCAGGGTCCCGTGGGGGTGG + Intergenic
1028607528 7:92671461-92671483 ACTCCAGAGATCCACGGGGGTGG + Exonic
1029193632 7:98789109-98789131 TCTCCAGGGACTCTCTGGCTTGG + Intergenic
1029408185 7:100390371-100390393 TCCCCAGGAACCTTCAGGGGAGG - Intronic
1029605905 7:101599269-101599291 TTTCCAAGGACCCGCGGGGCAGG + Intergenic
1033598754 7:142874462-142874484 TCTCTAGGGAGCTTGGGGGGAGG + Intronic
1034223189 7:149460829-149460851 TGCCCAGGCACCCTCGGGCGAGG + Exonic
1034267832 7:149789767-149789789 TGTCCAGGGAGCCTGGGGAGGGG - Intergenic
1034517757 7:151594028-151594050 TCCCCAGGGACCCCCAGGTGTGG - Intronic
1034690301 7:153008447-153008469 TCTTCAGGGTCCCTCGGCCGTGG - Intergenic
1034865524 7:154638228-154638250 TAACCAGGAACCCTCGTGGGAGG - Intronic
1035850960 8:2919009-2919031 TCTCCAGGGGCCCAGGGAGGGGG + Intergenic
1037529207 8:19757303-19757325 CCTCCAGGGACCCCGGGGGCGGG + Intronic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1038426981 8:27469939-27469961 TCTCCAGGAGCCCTGGGAGGTGG + Exonic
1038478732 8:27886932-27886954 CCTGCAGGGACCCTCCTGGGGGG - Intronic
1041044689 8:53879370-53879392 CCTCCGGGGAGCCTCGGGAGGGG - Exonic
1044797387 8:95917781-95917803 TCTCCAGGAATCCTCTGTGGAGG + Intergenic
1049263508 8:141652677-141652699 TCTCCCGGGACCCTGAGGAGGGG - Intergenic
1049329810 8:142044440-142044462 TCTCCACGGAGCCTCTGGTGAGG - Intergenic
1051944381 9:22549345-22549367 TCCACAGGGACACTCGTGGGGGG + Intergenic
1054161076 9:61672356-61672378 ACACCTGGGACCCTGGGGGGTGG + Intergenic
1055296687 9:74840493-74840515 TCTCCAGAGAACCTGGGGTGAGG + Intronic
1056709942 9:88984087-88984109 TCTGCAGGCACCCTGGGTGGTGG + Intergenic
1057355059 9:94325598-94325620 GCTCCAGGCACCCTCTGTGGAGG - Exonic
1057652692 9:96932036-96932058 GCTCCAGGCACCCTCTGTGGAGG + Exonic
1059115818 9:111599396-111599418 TCTCCAAGGAACTGCGGGGGCGG + Intronic
1061583912 9:131554587-131554609 GCTCCGGGGGTCCTCGGGGGTGG - Intergenic
1062008990 9:134257060-134257082 TCTCCAGGGAGCCCCGAGGCTGG + Intergenic
1062065953 9:134526325-134526347 TCTCCGGGGACCCTCCGTGGCGG - Intergenic
1062080053 9:134619011-134619033 CCTCCAGGCAGCCTCAGGGGTGG + Intergenic
1062351386 9:136141114-136141136 TCTCCAGGGCCTCTCGGAGGAGG + Intergenic
1062474279 9:136719724-136719746 GCTCCAGGGTCCCCCAGGGGTGG - Intronic
1185831645 X:3308879-3308901 TCTCCAGGAACCCTCCAGTGGGG - Exonic
1186486048 X:9935217-9935239 TCTCCCGGGAGCCGGGGGGGCGG + Intronic
1188440526 X:30211398-30211420 ACACCAGGGACTGTCGGGGGAGG + Intergenic
1188806890 X:34601790-34601812 CCTCCAGGGACTCTCAGGGAAGG - Intergenic
1188967148 X:36568464-36568486 TTTCCAGGGTCCCTCAGGTGTGG - Intergenic
1189290489 X:39881686-39881708 TCTGCAGGGGACCTCTGGGGCGG + Intergenic
1190640593 X:52480672-52480694 GCTCCAAGGTTCCTCGGGGGAGG - Intergenic
1190647079 X:52532193-52532215 GCTCCAAGGTTCCTCGGGGGAGG + Intergenic
1200100130 X:153686049-153686071 GCTCCATGGACCCTCGGAGTGGG - Intronic