ID: 1166267028

View in Genome Browser
Species Human (GRCh38)
Location 19:41690689-41690711
Sequence TCCAGGGACCCTCGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166267011_1166267028 26 Left 1166267011 19:41690640-41690662 CCTTGGGCTGGTTAGAGGTCTCC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1166267028 19:41690689-41690711 TCCAGGGACCCTCGGGGGTGGGG 0: 1
1: 0
2: 2
3: 43
4: 278
1166267013_1166267028 5 Left 1166267013 19:41690661-41690683 CCAGAGACCACAGCCAGGAGCCC 0: 1
1: 1
2: 4
3: 45
4: 471
Right 1166267028 19:41690689-41690711 TCCAGGGACCCTCGGGGGTGGGG 0: 1
1: 0
2: 2
3: 43
4: 278
1166267017_1166267028 -8 Left 1166267017 19:41690674-41690696 CCAGGAGCCCCCATCTCCAGGGA 0: 1
1: 0
2: 5
3: 62
4: 478
Right 1166267028 19:41690689-41690711 TCCAGGGACCCTCGGGGGTGGGG 0: 1
1: 0
2: 2
3: 43
4: 278
1166267014_1166267028 -2 Left 1166267014 19:41690668-41690690 CCACAGCCAGGAGCCCCCATCTC 0: 1
1: 1
2: 7
3: 87
4: 422
Right 1166267028 19:41690689-41690711 TCCAGGGACCCTCGGGGGTGGGG 0: 1
1: 0
2: 2
3: 43
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166267028 Original CRISPR TCCAGGGACCCTCGGGGGTG GGG Intronic
900142905 1:1145935-1145957 TCCTGGCACCCTCTGGGGTCTGG + Intergenic
900192426 1:1357072-1357094 TCCAAGGACCCTCGGGGGCTGGG - Intronic
900351627 1:2237845-2237867 TCCCGGGGCCCTCAGGGATGAGG - Intronic
900506340 1:3031485-3031507 TCCAGGGACACACGGGGGCCAGG + Intergenic
900799133 1:4726825-4726847 TTCAGGGTCCCTGGGGGATGGGG + Intronic
900983971 1:6062571-6062593 CCCAGGGACACCAGGGGGTGGGG - Intronic
901264703 1:7901961-7901983 TCCAGCGACCCTAGAGGGAGTGG + Intergenic
901678754 1:10901434-10901456 GCCAGGGCCCCTGGGGGGCGGGG - Intergenic
902032203 1:13431056-13431078 TCCAGAGCTCCTGGGGGGTGAGG - Intergenic
902337854 1:15764214-15764236 TCCAGGGTCACACGGTGGTGAGG - Intronic
903678692 1:25082876-25082898 TCCAGGGGTGCTCTGGGGTGAGG - Intergenic
905733696 1:40312529-40312551 TCGAGGGACTCTTGGGGGAGAGG - Intronic
906114689 1:43348935-43348957 TCCAGGGACCTTGGTAGGTGGGG - Exonic
910718482 1:90258250-90258272 ACCAGGGAGGCTCTGGGGTGGGG + Intergenic
910798498 1:91121710-91121732 TCTGGGGACACTTGGGGGTGTGG + Intergenic
911105702 1:94129762-94129784 TCCAGGGAGGCACGGGGGTAGGG + Intergenic
913118644 1:115719532-115719554 TCCAGGGACCATCTTGGGTCTGG - Intronic
913703709 1:121397531-121397553 TCCAGGGTCCCGTGGGGGTGGGG + Intergenic
913980061 1:143499240-143499262 TCCAGGGTCCCGTGGGGGTGGGG + Intergenic
914074409 1:144324725-144324747 TCCAGGGTCCCGTGGGGGTGGGG + Intergenic
914104767 1:144641721-144641743 TCCAGGGTCCCGTGGGGGTGGGG - Intergenic
915736246 1:158087411-158087433 CCCAGGGAACCATGGGGGTGTGG + Intronic
916612832 1:166409930-166409952 TCCAGGCACCAGCGGGGGTATGG + Intergenic
916635877 1:166667965-166667987 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
918662646 1:187108385-187108407 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
919751578 1:201041173-201041195 TCCAGGGACCTGGGGCGGTGTGG + Intronic
923470950 1:234290623-234290645 TCCAGGGCCCATCCAGGGTGGGG - Intronic
1063765381 10:9134251-9134273 ACCAGGGCCTGTCGGGGGTGAGG - Intergenic
1065106300 10:22389995-22390017 TGCGGTGACCCTCTGGGGTGTGG + Intronic
1065636593 10:27741854-27741876 GCCAGGGCCACTCGAGGGTGCGG - Intronic
1068646700 10:59476065-59476087 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
1069157001 10:65041962-65041984 ACCAGGGTCTGTCGGGGGTGTGG + Intergenic
1070277469 10:75020855-75020877 TCCAGGGACCCTTTCTGGTGTGG - Intronic
1070569608 10:77631234-77631256 CCCAGGGACCCTCGGAGGCAAGG - Intronic
1070862000 10:79677245-79677267 CCCAGGGCCTGTCGGGGGTGGGG - Intergenic
1075156653 10:119982830-119982852 TCCAGGGCCCCTGGGTGGAGAGG - Intergenic
1075703553 10:124484529-124484551 TCTAAGGACCCTCTGGTGTGAGG - Intronic
1076515847 10:131044067-131044089 TCCAGTGCCCCCCAGGGGTGAGG - Intergenic
1076887564 10:133269620-133269642 CCGAGGGGCCCTCGGGGGTGGGG - Intronic
1077466840 11:2737394-2737416 TCCAGGGGCCCCCGTGGGTCTGG - Intronic
1077554477 11:3219286-3219308 TCCAGAGACCCTCCGGGGAGGGG - Intergenic
1077600410 11:3570781-3570803 ACCAGGGCCCATCGGGGGTGGGG + Intergenic
1079550604 11:21692708-21692730 ACCAGGGCCTGTCGGGGGTGGGG - Intergenic
1081305773 11:41510278-41510300 CCTAGGGACCCTCGCGGGAGTGG + Intergenic
1083453363 11:62761598-62761620 CCCAGGGACTGTCGGAGGTGTGG + Exonic
1083611758 11:64007736-64007758 TGCCGGGACCCTCTGGCGTGGGG - Intronic
1083631109 11:64095974-64095996 TCATGGGCCCCTGGGGGGTGGGG - Intronic
1083680819 11:64351164-64351186 GCCAGGGCCCCGCGGGGCTGGGG + Exonic
1083895192 11:65616260-65616282 TCCCGGGACCCTCATGGGGGCGG - Exonic
1084256323 11:67945396-67945418 ACCAGGGCCCATCGGGGGTGGGG + Intergenic
1084284480 11:68122131-68122153 CCCAGGGACCGTCGAGGGAGGGG + Intergenic
1084394475 11:68899777-68899799 TCCAGGGATCCTCTGCAGTGGGG - Intronic
1084416413 11:69035420-69035442 GCCAGGGACCACCGGGAGTGGGG + Intergenic
1084561914 11:69910177-69910199 TGCAGGGACCCCGGGGTGTGGGG - Intergenic
1084642816 11:70435895-70435917 TCCAGAGACCCGCGGGGCAGGGG - Intronic
1084908657 11:72369458-72369480 TCCAGGGATCCTCTGGGGCAGGG + Intronic
1086505754 11:87502375-87502397 ACCAGGGCCTGTCGGGGGTGCGG - Intergenic
1091240585 11:134049594-134049616 TCCAGAGACCCCCTGGGGAGGGG - Intergenic
1095954157 12:47797011-47797033 CGCAGAGACCCTCGGAGGTGAGG - Exonic
1096029372 12:48398405-48398427 ACCAGGGCCTTTCGGGGGTGTGG - Intergenic
1096688832 12:53307074-53307096 TCAAGGCACCCTCTCGGGTGTGG - Exonic
1097371165 12:58783040-58783062 GCCAGGGACTCTCGGGCCTGTGG + Intronic
1101798628 12:108001128-108001150 TACAGGGAACCTCAGTGGTGAGG + Intergenic
1102182284 12:110921679-110921701 TCCAGCCACCCTAGAGGGTGGGG + Intergenic
1102402922 12:112646495-112646517 TTCAGGGACCCTGGAAGGTGTGG + Intronic
1102459818 12:113093443-113093465 TCCCGGGGCCCTCGGGTGGGTGG - Intronic
1102796699 12:115695211-115695233 TCCTGGGACCCTGTGGTGTGTGG - Intergenic
1103358927 12:120342388-120342410 TCTAAGACCCCTCGGGGGTGAGG - Exonic
1103698282 12:122834737-122834759 TCCAGGGACAATGGGGGCTGAGG - Intronic
1104078246 12:125409338-125409360 GCAAGGGACCCTCTTGGGTGTGG + Intronic
1104276450 12:127333082-127333104 TCCATGGACCCTGGGGCTTGAGG + Intergenic
1104981544 12:132575096-132575118 TGCAGGGTCCCACGGGGCTGAGG - Intronic
1105025468 12:132845769-132845791 TCCTGGGACCCTCGGGGACTTGG - Intronic
1105782386 13:23716056-23716078 GCCAGGGAACCACGGTGGTGTGG - Intergenic
1106214896 13:27688087-27688109 TCTAGGGATCCTCGGGACTGGGG - Intergenic
1110033357 13:70646863-70646885 ACCAGGGACTGTTGGGGGTGGGG - Intergenic
1112328078 13:98457138-98457160 CCCAGGGCCCCTCTGGGCTGGGG - Intronic
1113607281 13:111618697-111618719 TCCTGAGACCCTCGTGGGAGAGG - Intronic
1113682767 13:112255816-112255838 TCCAGGGCCCCTCGGCGTTTTGG - Intergenic
1113789272 13:113018967-113018989 TCCAGGCAGCCTCAGGTGTGTGG + Intronic
1113848432 13:113404923-113404945 TGCAGGGACCCTGGGAGGAGCGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114549634 14:23525510-23525532 ACCTGAGGCCCTCGGGGGTGGGG - Exonic
1114680836 14:24482349-24482371 GCCAGGGATCCTCGGGAGAGAGG - Intergenic
1115538615 14:34397484-34397506 ACCAGGGCCTGTCGGGGGTGGGG + Intronic
1116565889 14:46443636-46443658 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
1118844040 14:69533034-69533056 TCCAGGAGTCCTGGGGGGTGGGG + Intergenic
1120719776 14:87878338-87878360 TCCTGGGTCCCTCTGAGGTGAGG + Intronic
1122859788 14:104577406-104577428 TCCAGGCAGGGTCGGGGGTGGGG - Intronic
1122863004 14:104591033-104591055 TCCAGGGTCCCTCAGGGGATTGG - Intronic
1122892974 14:104741579-104741601 ACCAGGCCGCCTCGGGGGTGAGG - Intronic
1123129229 14:105972294-105972316 TCCAGGTGCCCCCCGGGGTGTGG - Intergenic
1123393385 15:19899781-19899803 TCCAGGGTCCCATGGGGGTGGGG + Intergenic
1123989875 15:25675521-25675543 TCCAGGGCCTCTCAGTGGTGTGG - Intergenic
1125747475 15:42006752-42006774 TCCAAGGATCCTGGGGGATGTGG + Intronic
1128704436 15:69828362-69828384 TGCTGGGACCCTCGGGGGCTGGG - Intergenic
1129188282 15:73923521-73923543 TCAAGGGACCCTCGGAGGGGTGG - Intergenic
1132558770 16:584146-584168 TCCAGGGAAGCTCTGGGGGGGGG + Intergenic
1132598487 16:763729-763751 TCGAGGGGCCCTCGGGACTGAGG + Intronic
1132646582 16:1002043-1002065 TCCAGGGAGCCCCAGGGGTGGGG + Intergenic
1133371737 16:5250427-5250449 ACCAGGGCCTGTCGGGGGTGAGG - Intergenic
1134800547 16:17080491-17080513 ACCAGGGCCTGTCGGGGGTGGGG - Intergenic
1134821716 16:17252413-17252435 ACCAGAGACCCTAGGGTGTGTGG + Intronic
1136699379 16:32117155-32117177 TCCAGGGTCCCGTGGGGGTGGGG + Intergenic
1136768268 16:32810779-32810801 TCCAGGGTCCCGTGGGGGTGGGG - Intergenic
1136799871 16:33060326-33060348 TCCAGGGTCCCGTGGGGGTGGGG + Intergenic
1136957773 16:34804339-34804361 TCCAGGGTCCCGTGGGGGTGGGG + Intergenic
1138561193 16:57801998-57802020 TCCAGGGAGCCCTGGGGGTGGGG + Intronic
1138896706 16:61214643-61214665 TGCAGGAACCCTTGGGGGTGTGG + Intergenic
1139261889 16:65602035-65602057 TTCAGGGATTCTTGGGGGTGGGG + Intergenic
1139673683 16:68508882-68508904 TCCAGGGATACTGGGGGGTCTGG - Intergenic
1139914334 16:70418896-70418918 TCCAGGAAGCCTCTGGTGTGGGG - Intronic
1140633996 16:76889140-76889162 CCCAGGGACTGTCGGGGGTTGGG + Intergenic
1141643018 16:85352464-85352486 TCCAGGGCCCCCTGGGAGTGGGG + Intergenic
1142224414 16:88870597-88870619 TGCAGGGACCCTCGTGGCTGGGG + Intergenic
1142265770 16:89063382-89063404 TCTAGGGACGCATGGGGGTGGGG + Intergenic
1142284691 16:89166965-89166987 TCTAGGGGCCTTGGGGGGTGTGG + Intergenic
1203070660 16_KI270728v1_random:1072795-1072817 TCCAGGGTCCCGTGGGGGTGGGG - Intergenic
1142570696 17:871897-871919 TCCTGGGAAACTCGGGGGTGAGG + Intronic
1143002814 17:3805735-3805757 TCCGGGGAGCATCAGGGGTGTGG - Intergenic
1143703823 17:8682593-8682615 ACCAGGGACTGTGGGGGGTGGGG - Intergenic
1144659437 17:17058546-17058568 TCCAGGGACTGTGGGGAGTGGGG + Intronic
1144776026 17:17785001-17785023 CCCAGGGGCCCATGGGGGTGGGG - Intronic
1144837367 17:18163730-18163752 TCCAGGGCCACCTGGGGGTGGGG - Exonic
1145235482 17:21205143-21205165 TCCACGGCCCCTCTGGGATGTGG + Intronic
1145254435 17:21314951-21314973 TGCTGGTACCCTAGGGGGTGGGG - Exonic
1147740441 17:42668240-42668262 TGCAGGGCCTCTCGGGGGAGGGG + Exonic
1149862323 17:60128950-60128972 GCCTGGGACCCTGGGAGGTGGGG - Intergenic
1151341955 17:73477305-73477327 TCCAGGTCACCCCGGGGGTGGGG + Intronic
1151419100 17:73985684-73985706 GCCAGGGACCTTCCTGGGTGGGG + Intergenic
1152567465 17:81106669-81106691 TCCAGGGAGCCACAGGGTTGTGG + Intronic
1152698311 17:81806978-81807000 TCCAGGGCCCCTCTGGGTTGGGG + Intronic
1152782238 17:82231518-82231540 TCCAGGAGGCCTCGGAGGTGGGG + Intronic
1153201747 18:2655118-2655140 TCCAGGGCCCCCAGAGGGTGCGG + Intergenic
1153717311 18:7863354-7863376 TCCAGGGCCTGTCGGGGGTGAGG - Intronic
1154518183 18:15197297-15197319 TCCAGGGTCCCGTGGGGGCGGGG - Intergenic
1158743338 18:60168242-60168264 TCCAGGGACCCTCAAGGGTAGGG - Intergenic
1160028035 18:75235026-75235048 ACCAGGAACCCTGGGGGCTGGGG - Intronic
1160528973 18:79552687-79552709 CCCCGGGACCCACGGGCGTGGGG - Intergenic
1160978465 19:1805847-1805869 GCTGGGGACCCTGGGGGGTGGGG - Intronic
1161072905 19:2271223-2271245 TTCGGGAAGCCTCGGGGGTGTGG + Intronic
1161245420 19:3249162-3249184 ACCAGGGACCATAGGGGGCGGGG + Intronic
1162036119 19:7940480-7940502 TCCTGGGGCCATCGTGGGTGTGG - Intronic
1162905116 19:13818521-13818543 TCCAGGCACACTCGCAGGTGAGG - Intronic
1162923647 19:13918823-13918845 TTCTGGGACCCTCTGGGGTTGGG + Intronic
1163663881 19:18594218-18594240 AGGAGGGACCCTCGGGCGTGGGG - Intronic
1164748228 19:30631419-30631441 TCCATGGACCCTGGTGGGAGGGG - Intronic
1164771348 19:30811797-30811819 TCCAGGGACCCTGGCTGATGGGG - Intergenic
1165739951 19:38199116-38199138 TCCAGGGAACCCAGGGAGTGAGG - Intronic
1165901117 19:39169793-39169815 GCCAGGGCCACTCGGGGGTTGGG - Intronic
1166131481 19:40748510-40748532 TCCAGGGACCCAGGTGGGAGGGG - Intronic
1166267028 19:41690689-41690711 TCCAGGGACCCTCGGGGGTGGGG + Intronic
1167320446 19:48794590-48794612 TCACGGGACCCTAGTGGGTGTGG - Intergenic
1167937978 19:52923014-52923036 TCCAGGGGCCGACGAGGGTGAGG + Intergenic
1167946491 19:52992933-52992955 TCCAGGGACCGACGAGGGTGAGG + Intergenic
1168059524 19:53883216-53883238 TCCTGGGACCCTCAGGAGGGTGG + Intronic
1202680084 1_KI270712v1_random:2230-2252 TCCAGGGTCCCGTGGGGGTGGGG - Intergenic
925081303 2:1069932-1069954 TCCAGGGAACCTAGGCGGTGAGG - Intronic
925362042 2:3286423-3286445 GCCAAGGACCCCCGGGGGTGGGG + Intronic
927123503 2:19990711-19990733 TAAAAGGACCCTCGGGGTTGCGG - Intergenic
927869083 2:26612523-26612545 ACCAGGGACCCTGGGAGGGGAGG - Intronic
929333948 2:40717270-40717292 GCCAGGGACCCTCGGGCCTTTGG + Intergenic
930058765 2:47272053-47272075 TCCAGGGCCCCTGGGGAATGTGG - Intergenic
931792249 2:65674516-65674538 TCCAGGGAACCTTGGAAGTGGGG + Intergenic
937916668 2:127102651-127102673 TCCAGGGCCCCTGGGGGATTGGG + Intronic
939181161 2:138803966-138803988 TCCAGGGACTCTTGGGCGTTTGG - Intergenic
944773099 2:202933466-202933488 TGCAGGGAACCTCAGTGGTGAGG + Intronic
948467519 2:238159295-238159317 TGCAGCAGCCCTCGGGGGTGAGG - Intronic
949043038 2:241858147-241858169 TCCAGGATCCCTCCTGGGTGGGG - Intronic
949073766 2:242042052-242042074 GCCAGGGGACCTCAGGGGTGGGG - Intergenic
1169266794 20:4172053-4172075 TCCAGGGAGCCTGGGGTGAGGGG + Intronic
1170059096 20:12240743-12240765 ACCAGGGCCTATCGGGGGTGGGG + Intergenic
1170524621 20:17226243-17226265 TCCAGTCACCATCGCGGGTGGGG + Intronic
1170853710 20:20028324-20028346 ACCAGGGCCTGTCGGGGGTGGGG + Intronic
1173865929 20:46312686-46312708 TCCCGGGTCCCTCTGGGGAGGGG - Intergenic
1174313534 20:49678610-49678632 TCCAGGTACCCTCGGGCCTTTGG + Intronic
1175271046 20:57734432-57734454 TCCAGGGACCAACGGGGGCAGGG - Intergenic
1175368109 20:58469330-58469352 GCCTGAGACCCTCAGGGGTGTGG - Intronic
1176169329 20:63689908-63689930 TCCAGGGGCCCAGTGGGGTGTGG - Intronic
1178981423 21:37267929-37267951 TCCGGTCACCCTCAGGGGTGCGG + Intergenic
1181055229 22:20257844-20257866 GGCAGGGACCCTGGGGTGTGGGG - Intronic
1181310116 22:21939986-21940008 GCTGGGGACCCTGGGGGGTGGGG + Intronic
1183349865 22:37329171-37329193 TGCAGGCACTGTCGGGGGTGAGG - Intergenic
1183428663 22:37752736-37752758 TCCGGGGACCCTGGGTGGGGAGG - Intronic
1184003286 22:41690724-41690746 TGCAGGGACCCTCAGTGCTGTGG + Exonic
1184479417 22:44738028-44738050 TCCAGGTGGCCTAGGGGGTGGGG + Intronic
1184649601 22:45913506-45913528 TCCAGGCCCCCCCAGGGGTGGGG - Intergenic
1184775545 22:46621065-46621087 TCCAGGGACCGTGGAGGGGGTGG + Intronic
1185141996 22:49107762-49107784 ATGAGGCACCCTCGGGGGTGGGG - Intergenic
1185289215 22:50015485-50015507 TCCAGGGTTCCCGGGGGGTGTGG - Intronic
950550159 3:13661440-13661462 TCCAGGCACCCAAGTGGGTGCGG + Intergenic
951105023 3:18732346-18732368 TCCAGGTACTCTGGAGGGTGAGG + Intergenic
952580726 3:34830872-34830894 ACCAGGGACCTTAGGGCGTGAGG + Intergenic
954796131 3:53162004-53162026 TCCAGGGACCCAGGGGCGGGAGG - Intronic
954852567 3:53616100-53616122 TCCAGTGACCCTGCAGGGTGAGG + Intronic
957071231 3:75569433-75569455 ACCAGGGCCCATCGGGGGTTGGG + Intergenic
958111131 3:89147171-89147193 ACCAGGGCCTGTCGGGGGTGGGG + Intronic
958494071 3:94819850-94819872 TCCAGGGCCTATTGGGGGTGTGG + Intergenic
959906633 3:111717635-111717657 TCCAGGGATCCTCCAAGGTGAGG + Intronic
960104397 3:113778276-113778298 TCCAGCTACCCTGGAGGGTGAGG + Intronic
961676958 3:128573540-128573562 ACCAGAGACACTCGGGGGTCTGG - Exonic
967930330 3:194686255-194686277 TCCAGCACCCCTCGGAGGTGGGG + Intergenic
968062882 3:195739581-195739603 GCCAGGGACCCTCGTGGGAGAGG - Intronic
968135314 3:196216340-196216362 TCCAGGAGCCTTCTGGGGTGGGG - Intronic
968262999 3:197340097-197340119 TGCAGTGTCCCTCGGGTGTGTGG + Intergenic
968472068 4:786851-786873 TCCAGGGACCCCCCGGGGTGGGG - Intronic
968510409 4:993102-993124 TCCAGGGACCCAGTGTGGTGGGG - Intronic
968553063 4:1233932-1233954 GGCAGGGACCCTCGTGGCTGTGG - Intronic
968559427 4:1270670-1270692 AGCAGGGCCCATCGGGGGTGGGG - Intergenic
968966507 4:3771591-3771613 GCCAGGGACCCCTAGGGGTGAGG + Intergenic
969014839 4:4097133-4097155 ACCAGGGCCCCTTGGGGGTGGGG + Intergenic
969244132 4:5921581-5921603 TCCAGGGAGGCTCAGGGGTGGGG + Intronic
969306903 4:6330962-6330984 GTCTGGGACCCTCGAGGGTGAGG + Intronic
969445570 4:7243033-7243055 TGCAGGGCCCCTGGGGGTTGAGG + Intronic
969798298 4:9542828-9542850 ACCAGGGCCCGTCGGAGGTGGGG - Intergenic
971185389 4:24370935-24370957 ACCAGGGACTTTCGGGAGTGAGG - Intergenic
972703656 4:41518738-41518760 ACCAGGGCCTATCGGGGGTGGGG - Intronic
973272553 4:48276456-48276478 TCCATTGACACTTGGGGGTGGGG - Intergenic
974356694 4:60821650-60821672 GCCAGGGACTCTCGGGGCTTTGG + Intergenic
974363989 4:60921691-60921713 TCCACGGACCATGGGGGTTGTGG + Intergenic
975131974 4:70839895-70839917 TCCAGGGCCGGTTGGGGGTGGGG + Exonic
976076637 4:81306543-81306565 ACCAGGGCCTGTCGGGGGTGGGG - Intergenic
982880904 4:160714033-160714055 AACAGGGTCTCTCGGGGGTGGGG + Intergenic
989697689 5:44222807-44222829 ACCAGGGACTGTCGGGGGTGGGG + Intergenic
992460319 5:76954016-76954038 TCCAGGCACCCTGGGGGAGGAGG - Exonic
994077622 5:95670995-95671017 TCCAGGGTCCTTGGGGGCTGGGG - Intronic
994780496 5:104083642-104083664 ACCAGGGACTGTCGGGGGTGGGG + Intergenic
1000548029 5:162625820-162625842 TCCAGGTGCCATTGGGGGTGGGG - Intergenic
1001494049 5:172175491-172175513 TCCTGGCACCCTGGTGGGTGGGG - Intronic
1002133613 5:177095615-177095637 TCCGAGGACCGTCGGGGCTGAGG - Exonic
1002434071 5:179220625-179220647 TCCAGAGACCCTGAGGAGTGAGG - Intronic
1002932505 6:1644183-1644205 TCCAGGGACCCACGCGGGGAGGG + Intronic
1004253378 6:14041080-14041102 ACCAGGGCCTCTCGGGGGTTGGG - Intergenic
1005006230 6:21290149-21290171 TCCAGGAACCCTCAGGGTTTGGG - Intergenic
1006163430 6:32050760-32050782 TCCAGGGAAACTCGGGGGAGAGG - Intronic
1006164049 6:32054149-32054171 TCCAGGGAAACTCGGGGGAGAGG - Intronic
1007336674 6:41159723-41159745 TGCAGAGCCCCACGGGGGTGGGG - Intronic
1007485006 6:42174891-42174913 TCCAGGCACCATCATGGGTGGGG + Intronic
1009431728 6:63572913-63572935 TGCCGGGCCCCTCGGGGCTGCGG + Intronic
1011054889 6:83193828-83193850 TCCTGGGTCCCTCGGGGCAGAGG + Exonic
1011288281 6:85748417-85748439 ACCAGGGCCTGTCGGGGGTGGGG - Intergenic
1012347411 6:98207693-98207715 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
1014272539 6:119349849-119349871 CCCAGGGTCCCGCGGGGGCGGGG + Intergenic
1016162438 6:140898081-140898103 GCCCGGGAGCCACGGGGGTGGGG + Intergenic
1018978302 6:168582404-168582426 TCCTGGGACCCTCTGGACTGAGG - Intronic
1019194411 6:170272803-170272825 GACAGGGACCCTCGGGGCTGCGG + Intergenic
1019312811 7:370977-370999 TGCTGGGCCCCTCGGGTGTGTGG - Intergenic
1019336524 7:485441-485463 TCCAGGGCCCCCAGGGGCTGGGG + Intergenic
1019774762 7:2905985-2906007 TCCTGGGACCCTGGGGTGTGTGG + Intergenic
1021653676 7:22854411-22854433 GTTAGGGCCCCTCGGGGGTGGGG + Intergenic
1022172345 7:27842236-27842258 TCCAGTAACCCTAGGAGGTGGGG + Intronic
1022256259 7:28661428-28661450 TCCAGGGAGCCAGAGGGGTGGGG - Intronic
1022471566 7:30684669-30684691 TCCAGGGGACCTCGGGTCTGTGG - Intronic
1023418006 7:39950303-39950325 TCCAAGTGCCCCCGGGGGTGGGG - Exonic
1025481993 7:60993138-60993160 TCCAGGGTCCCGTGGGGGTGGGG + Intergenic
1026869657 7:73842496-73842518 TCCAGCGCGCCTCGGGCGTGTGG + Exonic
1029652155 7:101901020-101901042 TCCAACGACCCTGGGAGGTGAGG + Intronic
1030973490 7:116090952-116090974 ACCAGGGCCTGTCGGGGGTGGGG + Intronic
1031268433 7:119612339-119612361 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
1031765521 7:125772466-125772488 GCCAGGGTCCCTGCGGGGTGTGG - Intergenic
1031778256 7:125928938-125928960 ACCTGGGCCCGTCGGGGGTGGGG + Intergenic
1031886512 7:127251237-127251259 CCCAGGGAACCGCGGGGGTGCGG + Intronic
1032020586 7:128405484-128405506 TGGAGGGGCCCTCGGGCGTGTGG - Intronic
1032373030 7:131378956-131378978 TCCACGGTCCCTAGGAGGTGGGG - Intronic
1034199984 7:149278320-149278342 ACCAGGGACCCTCTGGGGAAAGG - Intronic
1034275174 7:149820863-149820885 TCCAGGGACCCTGTGGGGCAAGG - Intergenic
1034787803 7:153941424-153941446 TCCTGGGCCCCTCTGGGGTTTGG + Intronic
1034964337 7:155382370-155382392 AGCAGGGACCCTCGGGGCGGCGG - Intronic
1035331088 7:158098026-158098048 TCGAGGGACGGACGGGGGTGTGG - Intronic
1035375692 7:158405171-158405193 TCCAGGCATCCTAGGGGGTGTGG - Intronic
1036244180 8:7102525-7102547 ACCGGGGCCCGTCGGGGGTGGGG - Intergenic
1036256561 8:7211215-7211237 ACCGGGGCCCATCGGGGGTGGGG + Intergenic
1036308611 8:7669800-7669822 ACCGGGGCCCATCGGGGGTGGGG + Intergenic
1036890040 8:12590724-12590746 ACCGGGGCCCATCGGGGGTGGGG + Intergenic
1037401279 8:18497475-18497497 TGCAGGGCCCCTTGGGGGAGAGG + Intergenic
1037434177 8:18845545-18845567 TCCAGCGGCCCTCATGGGTGTGG - Intronic
1037812338 8:22094540-22094562 CCCAGGGACCCTGGAGGGAGCGG + Intronic
1037820770 8:22133592-22133614 TCCCGGGACCCGCGGGGGTGGGG + Intergenic
1038331054 8:26609764-26609786 GGCAGGGACCCTGGGGGCTGGGG - Intronic
1039076162 8:33692354-33692376 TCCAGGGACTGTCGGGAGAGAGG - Intergenic
1040063641 8:43126459-43126481 TCAAGGGTCCCTCAGGGTTGAGG - Intergenic
1041647675 8:60270331-60270353 ACCAGGGACCCACTGGTGTGGGG - Intronic
1043236173 8:77869857-77869879 ACCAGGGCCTCTTGGGGGTGGGG + Intergenic
1045557743 8:103231035-103231057 TTCAGGTACCCTGGGAGGTGGGG - Intergenic
1048331912 8:133476408-133476430 TCCAGGGTCCCTCAGGAGCGAGG + Exonic
1049030932 8:140037000-140037022 ACCAGGGCCTGTCGGGGGTGGGG - Intronic
1049239709 8:141530990-141531012 TCCACGGAGCCTCGTGGTTGGGG + Intergenic
1053049690 9:34949835-34949857 ACCAGGGCCTCTCGGGGGTAGGG + Intergenic
1054161078 9:61672358-61672380 ACCTGGGACCCTGGGGGGTGGGG + Intergenic
1055208974 9:73766197-73766219 ACCAGGGCCAGTCGGGGGTGGGG + Intergenic
1055318715 9:75060394-75060416 ACCAGGGTCTGTCGGGGGTGGGG + Intergenic
1057251266 9:93504788-93504810 TCCAGGGAACCTCCAGGGTAGGG + Intronic
1057643283 9:96849148-96849170 TCCATGGACCAGCGGTGGTGGGG + Intronic
1058080928 9:100700380-100700402 ACCAGGGCCTATCGGGGGTGGGG + Intergenic
1058105546 9:100967082-100967104 ACCAGGGCCTGTCGGGGGTGGGG - Intergenic
1058507965 9:105685918-105685940 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
1060468584 9:123929708-123929730 TCCAGGGAGGCGCGGGGGCGGGG - Intronic
1061202547 9:129146093-129146115 TCCAGGGCCCTTGGGGGGTGGGG + Intronic
1061271640 9:129547105-129547127 TCCTGGGGCCCTCTGGGGAGAGG - Intergenic
1061706764 9:132458921-132458943 TCCAAGTACACTCAGGGGTGAGG + Intronic
1061779878 9:132989252-132989274 CCCAGGGAGCCTGGGGGCTGTGG + Intronic
1061974077 9:134059622-134059644 TCCAGGGTCCCTGTGGTGTGGGG - Intronic
1062474277 9:136719722-136719744 TCCAGGGTCCCCCAGGGGTGGGG - Intronic
1062478760 9:136742070-136742092 AGCTGGGAACCTCGGGGGTGGGG - Intronic
1203761291 EBV:13817-13839 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1203762220 EBV:16889-16911 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1203763149 EBV:19961-19983 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1203764078 EBV:23033-23055 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1203765007 EBV:26105-26127 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1203765936 EBV:29177-29199 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1203766865 EBV:32249-32271 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1203767794 EBV:35321-35343 TCCAGGGGTCCCCGAGGGTGAGG + Intergenic
1185486575 X:485727-485749 TTCGGGGACCCACGGGGGAGAGG - Intergenic
1187518288 X:19991353-19991375 TCCAGGGATCCTGGGGGTTAAGG + Intergenic
1187731593 X:22260703-22260725 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
1188440528 X:30211400-30211422 ACCAGGGACTGTCGGGGGAGGGG + Intergenic
1190597539 X:52063491-52063513 TCCAGGGCTCCGCCGGGGTGTGG - Intronic
1190611285 X:52190582-52190604 TCCAGGGCTCCGCCGGGGTGTGG + Intronic
1191663123 X:63670788-63670810 TTCAGGAGCCCTGGGGGGTGGGG + Intronic
1191817087 X:65257439-65257461 TCCAGGGCCTGTGGGGGGTGGGG + Intergenic
1192702273 X:73487376-73487398 ACCAGGGACAGTTGGGGGTGAGG + Intergenic
1192963694 X:76155439-76155461 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic
1194190721 X:90834041-90834063 TCCGGGGCCTGTCGGGGGTGGGG - Intergenic
1199021595 X:142884705-142884727 ACCAGGGCCTGTCGGGGGTGGGG + Intergenic