ID: 1166267857

View in Genome Browser
Species Human (GRCh38)
Location 19:41696097-41696119
Sequence AGGGCTGATGGCGCTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166267857_1166267863 9 Left 1166267857 19:41696097-41696119 CCCAGGACAGCGCCATCAGCCCT 0: 1
1: 1
2: 2
3: 12
4: 171
Right 1166267863 19:41696129-41696151 CTTTGCTAAACAGCAGTCAGAGG 0: 2
1: 0
2: 0
3: 22
4: 165
1166267857_1166267866 24 Left 1166267857 19:41696097-41696119 CCCAGGACAGCGCCATCAGCCCT 0: 1
1: 1
2: 2
3: 12
4: 171
Right 1166267866 19:41696144-41696166 GTCAGAGGAGGCCATGGCAGTGG 0: 2
1: 1
2: 7
3: 48
4: 481
1166267857_1166267865 18 Left 1166267857 19:41696097-41696119 CCCAGGACAGCGCCATCAGCCCT 0: 1
1: 1
2: 2
3: 12
4: 171
Right 1166267865 19:41696138-41696160 ACAGCAGTCAGAGGAGGCCATGG 0: 2
1: 0
2: 4
3: 41
4: 413
1166267857_1166267864 12 Left 1166267857 19:41696097-41696119 CCCAGGACAGCGCCATCAGCCCT 0: 1
1: 1
2: 2
3: 12
4: 171
Right 1166267864 19:41696132-41696154 TGCTAAACAGCAGTCAGAGGAGG 0: 2
1: 0
2: 0
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166267857 Original CRISPR AGGGCTGATGGCGCTGTCCT GGG (reversed) Intronic
900189109 1:1345853-1345875 AAGGCTGAGGGCCCTGACCTGGG - Intronic
905256951 1:36690986-36691008 ATCCCTGATGGTGCTGTCCTGGG + Intergenic
905652865 1:39668247-39668269 AGGGGTGATGGCCCTGTCCCTGG - Intronic
908333182 1:63092075-63092097 AGCTCTGATGGCGATGTACTAGG - Intergenic
911664689 1:100539443-100539465 GGGCATGCTGGCGCTGTCCTGGG + Exonic
913200865 1:116494427-116494449 AGAGCTGATGGCGCCTTCATGGG + Intergenic
914342773 1:146774425-146774447 GAGGCTGGTGGCGCTGTCCACGG + Intergenic
916713385 1:167431457-167431479 AGGGCTTACGGCCCTGGCCTTGG - Exonic
920560381 1:206934389-206934411 AGGGGTGCAGGCCCTGTCCTTGG + Intronic
921834307 1:219762114-219762136 AGGGGTGGTGGAGCTGACCTCGG - Intronic
922421493 1:225463583-225463605 AGGGCTGAAGGAGCAGTTCTTGG + Intergenic
923419919 1:233802708-233802730 AGGTCTGATGGCCCAGTCTTGGG + Intergenic
923450378 1:234111746-234111768 AGCTCTGAGGCCGCTGTCCTGGG - Intronic
923497734 1:234539873-234539895 AGAGCTGATGAGGCTGTGCTTGG + Intergenic
1068006165 10:51394025-51394047 AGGGCTGATGGCCTTCTCCTGGG - Intronic
1069610298 10:69768282-69768304 GGGGCTGAGGGCTCTGGCCTCGG + Intergenic
1070867009 10:79712763-79712785 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1070880799 10:79850884-79850906 GGGGCTGCTGCCTCTGTCCTCGG + Intergenic
1071500892 10:86203693-86203715 TGTGCTCATGGCGCTGTCCAGGG - Intronic
1071633921 10:87234986-87235008 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1071647371 10:87367203-87367225 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1075831000 10:125410894-125410916 AAGGCTGATGGTCCTGCCCTGGG + Intergenic
1077151038 11:1073275-1073297 AGGGCTGGAGGGGCTGTGCTGGG + Intergenic
1077331520 11:1985891-1985913 TGGCCTGATGCCTCTGTCCTTGG - Intergenic
1078566194 11:12416563-12416585 AGGGCAGATGGCGCTGGAGTCGG - Intronic
1083968766 11:66059493-66059515 AGGGCTGATTGTTCTGTTCTAGG + Exonic
1084114181 11:67032271-67032293 AGGGCTGGTGGCTCTGTCTTGGG - Intronic
1084677505 11:70644552-70644574 AGGGCTGCTGGTCCTGCCCTTGG - Intronic
1084754210 11:71224520-71224542 AGGGTGGATGGCATTGTCCTTGG - Intronic
1084974558 11:72789711-72789733 GGGGCTGAAGGCTCTGCCCTGGG + Intronic
1090808540 11:130217866-130217888 AGGGGTGATGGGGCGGGCCTCGG + Intergenic
1202814501 11_KI270721v1_random:41067-41089 TGGCCTGATGCCTCTGTCCTTGG - Intergenic
1092252451 12:6907473-6907495 AGGGAAGAGGGCACTGTCCTGGG + Intronic
1097719392 12:63003457-63003479 AGGGCTGAAGGTGCTGCCCACGG + Intergenic
1103356589 12:120325992-120326014 AGGGCTGATGCCGCTGTCGGCGG + Exonic
1103602189 12:122061432-122061454 AGGGCTGCTGGCGCTTTGCCTGG - Exonic
1103920997 12:124399145-124399167 GGGGCTGATGGGGCTGCCCATGG - Intronic
1103938064 12:124486864-124486886 AGGTCTGATGGGGCTGTCTGAGG + Intronic
1104811671 12:131623377-131623399 AGGGCCCATGGCCCTGGCCTTGG + Intergenic
1106141311 13:27014614-27014636 AGGGCAGCAGGTGCTGTCCTTGG - Intergenic
1106144838 13:27041230-27041252 AGGGCAGATGGCTCAGGCCTTGG - Intergenic
1110555795 13:76857855-76857877 AGAGATGATGGAGCTGGCCTGGG - Intergenic
1112875215 13:104029246-104029268 AGGTGTGATGACTCTGTCCTAGG - Intergenic
1113756217 13:112812818-112812840 AGAGCAGATGGCCCTGGCCTGGG + Intronic
1114616998 14:24073611-24073633 GGGGCTGGTGGCTCCGTCCTCGG - Exonic
1117911527 14:60642254-60642276 AGGGCAGATGGCGCAGGCCTTGG - Intergenic
1121104569 14:91272002-91272024 AGGGCAGCTGGCGGTGGCCTTGG - Exonic
1122910564 14:104825949-104825971 AGGCCTTATGGAGCTCTCCTGGG + Intergenic
1122955927 14:105071054-105071076 AGGTCTGATGACTCTCTCCTCGG + Intergenic
1123413954 15:20081685-20081707 AGGGCTGCTGGCCATGACCTAGG - Intergenic
1123523296 15:21088796-21088818 AGGGCTGCTGGCCATGACCTAGG - Intergenic
1127500411 15:59549347-59549369 GGGGCAGTTGGCGCTTTCCTAGG + Intergenic
1128509479 15:68304539-68304561 AGGACTGAGGGAGCTGGCCTGGG - Intronic
1130843439 15:87723227-87723249 AGGGCTGATGGGGCTGGCAGGGG - Intergenic
1130986725 15:88849308-88849330 AGGGGTGATGGAGCTGGGCTGGG + Intronic
1131957947 15:97757751-97757773 ATGGCTGCTGGTGCTGGCCTTGG - Intergenic
1132626728 16:894928-894950 AGAGCTGACAGGGCTGTCCTGGG + Intronic
1132666582 16:1083670-1083692 AGGGCAGAGGGGCCTGTCCTAGG - Intergenic
1133404109 16:5509415-5509437 ATGGCTGAGGCCCCTGTCCTTGG - Intergenic
1133988834 16:10689380-10689402 AGAGCTGAGGGCTCTGGCCTGGG - Intronic
1135424608 16:22326061-22326083 AGGGGTGCTGGCGCAGCCCTGGG - Exonic
1136129456 16:28211165-28211187 AGGGATGATGGCTCAGGCCTGGG - Intronic
1136524698 16:30821437-30821459 AAAGCTGCTGTCGCTGTCCTGGG + Intergenic
1137248696 16:46727501-46727523 AGGGCTGCTGCCACTGCCCTTGG + Intronic
1139953055 16:70681189-70681211 CATGCTGATGGCTCTGTCCTTGG - Intronic
1142306203 16:89287297-89287319 AGGGCCCATGGGGCTGCCCTGGG + Intronic
1142942919 17:3397963-3397985 CGCCCTGGTGGCGCTGTCCTGGG - Exonic
1144703529 17:17353307-17353329 AGGCCTGCTGGGGCTGCCCTAGG + Intergenic
1144718381 17:17450454-17450476 TGCACTGATGGTGCTGTCCTGGG + Intergenic
1145159795 17:20566868-20566890 AGCCCAGATGTCGCTGTCCTCGG - Intergenic
1145230862 17:21172324-21172346 GGGCCGGATGGCACTGTCCTTGG + Intronic
1146442884 17:32912552-32912574 CTGGCTGGTGGCGCTGTCCTTGG + Intergenic
1147554890 17:41471826-41471848 AGCCCTGATGGAGCTGTCCAAGG - Intergenic
1148744774 17:49912111-49912133 AGGGGTGAGGGAGCTATCCTGGG - Intergenic
1150590764 17:66560133-66560155 AGAGCTGATGGGGGTGTGCTTGG + Intronic
1152602364 17:81270865-81270887 AGGGCTGATGGGTCTGGGCTGGG - Intronic
1155156805 18:23164381-23164403 GGGGCTGATGGCGGGGCCCTGGG - Intronic
1156474047 18:37394641-37394663 AGGGGTGCTGGGGCTGTCGTGGG - Intronic
1157608780 18:48942924-48942946 AGGGCAGAAGGCTCTCTCCTTGG + Intronic
1160500910 18:79400735-79400757 AGGGCTGGTGGCGCTGCCAGAGG + Intronic
1160808682 19:1003531-1003553 AGGGCTGCTGGCGCTGGGCGAGG + Exonic
1161287522 19:3476717-3476739 AGGGCTGGGGGCTCTGTCTTGGG - Intronic
1161343033 19:3753102-3753124 AGGGCAGAAGGCTGTGTCCTGGG - Intronic
1161583904 19:5094871-5094893 TGGGCTGGTGGCCGTGTCCTGGG + Intronic
1161957710 19:7505856-7505878 AGGGGTGAGGGAGCTGTCCAAGG + Intronic
1162964946 19:14151179-14151201 CCGGCTGGTGGCGCCGTCCTCGG + Exonic
1163020830 19:14480041-14480063 AGGGCTGAGGGCGCTTGGCTGGG + Intronic
1164231010 19:23288889-23288911 GGGGCTGATGGTGATGGCCTGGG - Intergenic
1164247430 19:23444559-23444581 GGGGCTGATGGTGATGACCTGGG - Intergenic
1165152316 19:33768040-33768062 AGCGCTGATGGAGCTGTCCAGGG + Intronic
1166267857 19:41696097-41696119 AGGGCTGATGGCGCTGTCCTGGG - Intronic
1166499821 19:43332408-43332430 GGGGCTGATGGCGCTGTCCTGGG + Intergenic
1166746696 19:45145176-45145198 CGGGCTCATGGCACTGTCGTTGG + Exonic
1166812514 19:45522639-45522661 AGGGCTGCCGGCGGTGTCATTGG + Intronic
1167672126 19:50859404-50859426 AGTGATGATGGGGCTGACCTGGG + Intronic
1167998102 19:53423109-53423131 GGGGCTGATGGTGATGGCCTGGG - Intronic
1168007580 19:53503703-53503725 GGGGCTGATGGTGATGGCCTGGG - Intergenic
1168163960 19:54533888-54533910 AGGGCTGATGGTGATGTTGTTGG - Exonic
925400740 2:3570475-3570497 AGGGCTGAGGGAGCTCTCCAGGG - Intergenic
925704828 2:6674400-6674422 AGGGTTGATGGTGCTGTGCCAGG + Intergenic
929029357 2:37636239-37636261 AGGGCTGTTGTGGCTGGCCTGGG - Intergenic
932017693 2:68049295-68049317 AGCGCTTATGGCTCTGTTCTTGG - Intronic
934134830 2:88985306-88985328 CAGGCTGATGTCTCTGTCCTGGG + Intergenic
934235476 2:90228448-90228470 CAGGCTGATGTCTCTGTCCTGGG - Intergenic
934494883 2:94788245-94788267 GGGCCTGATGGGGTTGTCCTGGG + Intergenic
935933733 2:108158345-108158367 TGGGCTTATGGCTCTGTCCTTGG - Intergenic
937161919 2:119771712-119771734 AGGGCTGATAGGGCTGTGATAGG - Intronic
937986581 2:127640761-127640783 AGGGCTGAGGGTGCAGGCCTGGG + Intronic
938254975 2:129850574-129850596 ATGGCTGATGCTGCTGTGCTAGG - Intergenic
941857496 2:170245787-170245809 AGGACTGAGGACCCTGTCCTGGG - Intronic
943420968 2:187668601-187668623 AGCGCTGATGGCGATGTACAAGG + Intergenic
944104753 2:196068398-196068420 AGTGCTAATGGCGGTGTGCTTGG - Intronic
944502088 2:200372338-200372360 AGGGCAGGTGAAGCTGTCCTGGG - Intronic
946339862 2:219060135-219060157 AGGGCGGATCGCGCTCACCTGGG + Exonic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
948346324 2:237301786-237301808 GAGGGTGATGGCGCTATCCTTGG + Intergenic
949049669 2:241890824-241890846 GGGACTGTTGGTGCTGTCCTGGG - Intergenic
1170431264 20:16278920-16278942 AGGCCTGATGGTGCTTTCGTGGG + Intronic
1172357983 20:34292881-34292903 AGGGTTGATGCCTCAGTCCTTGG - Intronic
1176263301 20:64194608-64194630 AGCTCTGAGGGCCCTGTCCTGGG + Intronic
1176369571 21:6054133-6054155 AGGGCTGATGGTGCAGGCCCTGG + Intergenic
1178297194 21:31420283-31420305 GAGGCTGATGTGGCTGTCCTGGG - Intronic
1179753948 21:43484408-43484430 AGGGCTGATGGTGCAGGCCCTGG - Intergenic
1182546167 22:31077882-31077904 AGGGCTGCTGGCCATGACCTAGG + Intronic
1183518071 22:38279234-38279256 AGAGCTGATGGCTCTGTCCTAGG - Intergenic
1183778042 22:39980699-39980721 AGGGATGACGGCACAGTCCTGGG - Intergenic
1184654954 22:45936441-45936463 AGGGCCGATGGGGCTGGCCTTGG - Intronic
1185097833 22:48821397-48821419 AGGGCTGAGAGCTCAGTCCTTGG + Intronic
1185220119 22:49624990-49625012 CGGGCTGACGGCGCCATCCTGGG + Intronic
950654688 3:14429197-14429219 AGGCATGTTGGCTCTGTCCTGGG + Intronic
952826790 3:37531085-37531107 AGCGCTTGTGGTGCTGTCCTTGG + Intronic
954427108 3:50449259-50449281 AGGGCTCATGGTGAGGTCCTAGG - Intronic
954593172 3:51801596-51801618 ATGGGCAATGGCGCTGTCCTGGG + Intergenic
960549258 3:118955546-118955568 AGTGCTGATGGAGCTGTACAAGG - Intronic
960610494 3:119550911-119550933 AGGGAGGATGGCGCTGTTCAAGG - Intronic
961216663 3:125165285-125165307 AGGGTTGAGCCCGCTGTCCTGGG + Intronic
962158501 3:132974595-132974617 AGGGCTGATTTATCTGTCCTGGG + Intergenic
962277660 3:134028604-134028626 AGGGATGATGGGGGTGTCCGTGG - Intronic
965908613 3:173742305-173742327 AGGGCTGATGTCGCTGTACTAGG + Intronic
967123808 3:186407130-186407152 GGGGGTGATGGCCCTGTCCCGGG + Intergenic
967325566 3:188235167-188235189 AGAGCAGGTGGTGCTGTCCTGGG + Intronic
968425696 4:521854-521876 TGGGGTGATGGTGCTGGCCTCGG + Exonic
969686104 4:8675151-8675173 AGGCATGATGGAGCTGTCTTTGG + Intergenic
980791730 4:137629690-137629712 AGTGCTGATGTTGCTGCCCTGGG + Intergenic
985591725 5:768985-769007 AGGGCTCATGGCACTGCACTGGG - Intergenic
985609641 5:879944-879966 AGGGCTCATGGCACTGCACTGGG - Intronic
985950464 5:3218493-3218515 AGGGATGATGACTTTGTCCTGGG - Intergenic
990862450 5:60341843-60341865 AGGGCTGATGGGTCTGTGTTTGG - Intronic
992009339 5:72511121-72511143 AGGGGGGATGGCGCAGTCCCCGG + Intergenic
997626052 5:135331189-135331211 AGGGCTGAAGTGGCTGTCCTAGG + Intronic
998420267 5:141978909-141978931 AGGGCTCATGGGGCAGTCCGAGG + Intronic
1001264235 5:170260947-170260969 AGGGCTGGTGCCTCTGTCTTTGG - Intronic
1002021054 5:176364897-176364919 AGGGCTGACTGCCTTGTCCTAGG - Intergenic
1002583078 5:180222316-180222338 AGTGGTGATGAAGCTGTCCTGGG - Intergenic
1007625297 6:43243266-43243288 AGGAGTGATGGGGCTGTGCTGGG + Intergenic
1018972678 6:168539551-168539573 AGGCCTGAGCCCGCTGTCCTGGG - Intronic
1019121486 6:169808396-169808418 AGTGCTGAGGGAGCTGTGCTGGG - Intergenic
1019617740 7:1973865-1973887 AGGGCTGATGGCAGGGACCTTGG - Intronic
1021424381 7:20483163-20483185 AGGGCTGCTGGCTATGTCTTAGG - Intergenic
1022329103 7:29360788-29360810 GGAGCTGATGGGGCTGGCCTGGG + Intronic
1022695842 7:32704727-32704749 AGGGCAGAGGGCTCTTTCCTAGG + Intergenic
1029340208 7:99936531-99936553 AGGGCTAAGGGTGCTGCCCTTGG - Intergenic
1029519350 7:101050342-101050364 TGGGGTGATGACTCTGTCCTAGG - Intronic
1034940635 7:155228165-155228187 AGGGCTCAGGCCACTGTCCTGGG + Intergenic
1035693878 8:1578873-1578895 AGGGCTGATGGCCCCGTCTGTGG + Intronic
1036069074 8:5420173-5420195 AGAGCTAAAGGCACTGTCCTGGG + Intergenic
1036588594 8:10147607-10147629 AGGGGCCATGGGGCTGTCCTGGG + Intronic
1037334840 8:17781983-17782005 AGGTTAGAGGGCGCTGTCCTTGG - Intronic
1037511158 8:19584876-19584898 AGGGATGGTGACACTGTCCTGGG + Intronic
1038704583 8:29881636-29881658 ATGGCTGGTGGCTCTGTCCCAGG - Intergenic
1039582684 8:38679960-38679982 TGGGCTCATGGCCCTGCCCTCGG + Intergenic
1040941064 8:52834131-52834153 AAGGCTTAAGCCGCTGTCCTGGG - Intergenic
1047337853 8:123953544-123953566 ATGGCTGAAGACGCTGTCATGGG - Intronic
1053288459 9:36864732-36864754 AGGGCTGATGGCGCTGACGGAGG + Intronic
1053662236 9:40292113-40292135 GGGCCTGATGGGGTTGTCCTGGG - Intronic
1053912687 9:42922281-42922303 GGGCCTGATGGGGTTGTCCTGGG - Intergenic
1054374364 9:64438342-64438364 GGGCCTGATGGGGTTGTCCTGGG - Intergenic
1054522374 9:66084171-66084193 GGGCCTGATGGGGTTGTCCTGGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056935523 9:90912756-90912778 TGGACTGATGGCGGTGTCCTGGG - Intergenic
1057261583 9:93587554-93587576 AGGGATGATGGAGGAGTCCTGGG + Intronic
1057353433 9:94318168-94318190 AGGGCTGCTGCCTCTGCCCTTGG - Intergenic
1057654318 9:96939424-96939446 AGGGCTGCTGCCTCTGCCCTTGG + Intronic
1057891105 9:98870520-98870542 AGGGCTGATGGGCATGTGCTAGG - Intergenic
1060797566 9:126522894-126522916 AAGGCTCCTGGTGCTGTCCTGGG + Intergenic
1062311293 9:135938847-135938869 TGGGCTGATGGAGCTGTGCCTGG - Intronic
1199996729 X:153030673-153030695 AGGGCTGATGGTGGTGGCCAGGG - Intergenic