ID: 1166267951

View in Genome Browser
Species Human (GRCh38)
Location 19:41696598-41696620
Sequence TGGTGACAGGCAGTGACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166267946_1166267951 -7 Left 1166267946 19:41696582-41696604 CCAGTGAGCCCAGAGATGGTGAC 0: 2
1: 1
2: 2
3: 25
4: 205
Right 1166267951 19:41696598-41696620 TGGTGACAGGCAGTGACCCAGGG 0: 1
1: 0
2: 4
3: 38
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166267951 Original CRISPR TGGTGACAGGCAGTGACCCA GGG Intronic
900980842 1:6045314-6045336 CTGTGACACGCAGTGACCCTGGG + Intronic
901068183 1:6504484-6504506 TGGTCACAGGCAGGGACGCCTGG + Intronic
902275872 1:15338802-15338824 TGGAAACATGCAGTGACCCCAGG - Intronic
902374750 1:16025124-16025146 TGGTGCCAGGAAGGGGCCCATGG + Intronic
902923814 1:19682830-19682852 TGGGGACAGGCAGCTTCCCAAGG + Exonic
903682704 1:25107699-25107721 TGGAGTCAGGCAGAGACTCATGG + Intergenic
904033869 1:27549020-27549042 TGGTGGCAGGCAGGGGCCCCCGG + Exonic
904316501 1:29669610-29669632 TGGGGAGGGGCACTGACCCAGGG - Intergenic
904948336 1:34215534-34215556 TGGATAAAGGCAGTGACCCTGGG + Intronic
905193753 1:36257579-36257601 TGGTGGCAGGGGGTGACTCAGGG + Intronic
905314618 1:37074035-37074057 TGGTGACATGCAGTGACAAGGGG + Intergenic
905735814 1:40325056-40325078 GAGTGAGAGACAGTGACCCAGGG - Intergenic
906627260 1:47334813-47334835 GGGAGACAGGAAGTGACCGAGGG - Intronic
908058226 1:60316203-60316225 TGGTGACAGTTATTGTCCCATGG + Intergenic
912475959 1:109934966-109934988 GGGTTACAGGCAGTGAGGCATGG + Intergenic
912507268 1:110164976-110164998 TGGAGACAGGCTCTGAGCCAAGG + Intronic
915084457 1:153375596-153375618 TGGTGAAGGGCACTGAGCCAAGG + Exonic
916212762 1:162372237-162372259 GAGTGCCTGGCAGTGACCCAGGG + Intronic
918126747 1:181590611-181590633 TCTTGAGAAGCAGTGACCCAAGG + Intronic
921888249 1:220327799-220327821 TGGTGACAGGCAGTGAAGGAGGG + Intergenic
922190025 1:223310142-223310164 TGGTTAAAGGCACTGTCCCAGGG - Intronic
922776212 1:228215280-228215302 TGGAGACAGGCAGGCTCCCAGGG - Intronic
923051124 1:230392252-230392274 TGGGGATAAGCACTGACCCACGG + Intronic
1062805820 10:418571-418593 TGGTAACAGGCTGTGGCCGAGGG - Intronic
1062854187 10:771409-771431 CGGTGACTTGCATTGACCCAGGG - Intergenic
1063993644 10:11595009-11595031 GGGTGACAGGCAGTGGCTCTAGG + Intronic
1066991901 10:42523247-42523269 TGGAGACAGGCAAGGAGCCATGG - Intergenic
1067091473 10:43267698-43267720 TGGTTAAGGGGAGTGACCCAAGG - Intergenic
1069270645 10:66522931-66522953 TGGTGACAGGAAGTGACTTAAGG - Intronic
1069550268 10:69359461-69359483 AGCTGACATGCAGAGACCCAGGG + Intronic
1069994550 10:72334571-72334593 TGGTGACATGCACTGAGCCAAGG - Exonic
1071858290 10:89647321-89647343 TGAGGAGAGGCAGTGATCCAAGG - Intergenic
1073242694 10:102068507-102068529 TGGAGACAGGCAAGGACCCAGGG - Intergenic
1075399935 10:122153546-122153568 TTGTGAGAGGCAGTGAAGCAGGG + Intronic
1076345230 10:129774833-129774855 TGGAGGCAGCCAGTGGCCCACGG - Intergenic
1078230917 11:9442104-9442126 TGGTATCAGGCACTGACTCACGG + Exonic
1078868608 11:15323018-15323040 TGGTCACAGGCAATCACCCCAGG - Intergenic
1083731593 11:64655253-64655275 TGGTGCCAGGCTGTGGCCCAGGG - Intronic
1083755824 11:64791181-64791203 TGGTGCCAGGCCCTGAGCCAGGG - Intronic
1084225180 11:67711154-67711176 TGGTGACAGGCCCTGACCTAGGG - Intergenic
1084262999 11:67990997-67991019 TGGTGACAGGCCCTGACCTAGGG - Intergenic
1084554194 11:69865948-69865970 TGGGAACAGGCAATGCCCCAGGG + Intergenic
1084620383 11:70266002-70266024 GGGTGACATGCTGTCACCCAAGG - Intergenic
1084810393 11:71608119-71608141 TGGTGACAGGCCCTGACCTAGGG + Intergenic
1085521502 11:77141727-77141749 GGGTGACAAGCAGTCAGCCAAGG - Intronic
1087170098 11:95041347-95041369 AGTTGACAGGCAGAGAACCAGGG - Intergenic
1089646914 11:119886500-119886522 TGGTGGCAGACAGGGACCCTAGG - Intergenic
1090137836 11:124217621-124217643 TGGTGTCTTACAGTGACCCAGGG - Intergenic
1090648159 11:128783085-128783107 TGGGGACAGACAGCGAGCCAAGG - Intronic
1090662412 11:128891496-128891518 TAGAGAAAGGGAGTGACCCAAGG + Exonic
1093147172 12:15580729-15580751 TGGTTTCAGGCAGTGGCCCCTGG - Exonic
1093521109 12:20051246-20051268 TGATGACAGGGAGTGACCTTTGG + Intergenic
1095838046 12:46660077-46660099 TGGAGACAGGCAGATACCCCGGG - Intergenic
1096230132 12:49892168-49892190 AGGTGGCAGGCAGGGATCCAAGG - Intronic
1097362296 12:58671320-58671342 TGGTGAAAGACAATGACCCTGGG + Intronic
1100621680 12:96282210-96282232 TGATGACAGGCATTGTCCCTAGG - Intronic
1101561720 12:105863487-105863509 TGGTTATAGGCAGAGACTCAGGG - Intergenic
1101593017 12:106139566-106139588 CGGTTACAGGCGGTGACTCACGG + Exonic
1101970129 12:109307213-109307235 TGGTGAGTTGCAGTGACCCCGGG + Intronic
1102033403 12:109757736-109757758 TGGGAACAGGCAGGGAGCCAGGG + Intronic
1106545864 13:30730824-30730846 TGGGGCCAAGCAGTGACTCAGGG - Intronic
1108824954 13:54401733-54401755 TGTTGACAGCCAGTTACCAATGG - Intergenic
1110278824 13:73669037-73669059 CTGTGACAGGCAGTGACTTAAGG - Intergenic
1110304524 13:73969694-73969716 TGGTGCCAAGCAGTATCCCAGGG - Intronic
1112386558 13:98945570-98945592 AGGTGAGAGTGAGTGACCCAAGG - Intronic
1113060145 13:106314069-106314091 ACGTGACAGGCAGTGGCTCACGG + Intergenic
1113454464 13:110438340-110438362 TGAGGACAGGCAGTGACAGAGGG - Intronic
1113616393 13:111683650-111683672 TGGTGATAGGCTGTGTCCCCTGG + Intergenic
1113616405 13:111683738-111683760 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113616412 13:111683780-111683802 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621861 13:111768543-111768565 TGGTGATAGGCTGTGTCCCCTGG + Intergenic
1113621868 13:111768585-111768607 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621875 13:111768627-111768649 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621882 13:111768669-111768691 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621889 13:111768711-111768733 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621896 13:111768753-111768775 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621903 13:111768795-111768817 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621910 13:111768837-111768859 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621917 13:111768879-111768901 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621924 13:111768921-111768943 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621931 13:111768963-111768985 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113621950 13:111769097-111769119 TGGTGACAGGCTGTGTCCCCTGG + Intergenic
1113649789 13:112027322-112027344 GGGGGACAGGCTGAGACCCACGG + Intergenic
1113649830 13:112027434-112027456 TGGGGACAGGCTGAGACCCGGGG + Intergenic
1113756826 13:112818194-112818216 TGGTGACGGGCAGTGACTGTTGG + Intronic
1113756842 13:112818283-112818305 TGGTGACAGGCGATGACCGTTGG + Intronic
1113893179 13:113747385-113747407 TGGTGACAGCCCCTGACGCAAGG + Intergenic
1114657224 14:24323352-24323374 TGATGAGAGGCAGAGACCCAGGG + Exonic
1117995150 14:61471161-61471183 TGGTGAGGGCCAGTGGCCCATGG + Intronic
1118744380 14:68763210-68763232 TGGCGGGAAGCAGTGACCCAGGG - Intergenic
1120195222 14:81474735-81474757 TGCTGGCAGCAAGTGACCCAGGG + Exonic
1121188428 14:91998969-91998991 TGGTAAGAGGCAGTGATCTAGGG + Intronic
1121793787 14:96719400-96719422 AGGTTGCAGGCAGTGAGCCAGGG - Intergenic
1123449067 15:20349208-20349230 TGGTGACAGGCAAGGGCACAGGG - Intergenic
1124069215 15:26375965-26375987 TGATGACAGACAGTGGGCCAGGG - Intergenic
1124173987 15:27404702-27404724 GTGTGACAGGCAGTCATCCAGGG + Intronic
1124580657 15:30951898-30951920 TGGGGACAAGCAGTAAACCAAGG + Intronic
1125599171 15:40906358-40906380 TGGCCACAGGCAGTGACGCTGGG + Intergenic
1128889531 15:71318320-71318342 TGGAGACAGACAGAGAGCCAGGG + Intronic
1129871739 15:78945528-78945550 TGGAGACAGGCAGGGACATAGGG - Intronic
1129871759 15:78945591-78945613 TGGGGACAGGCAGGGACATAGGG - Intronic
1129871824 15:78945781-78945803 TGGGGACAGGCAGGGACATAAGG - Intronic
1129871894 15:78946001-78946023 TGGGGACAGGCAGGGACATAGGG - Intronic
1131377087 15:91934408-91934430 TTTTGGCAGACAGTGACCCATGG - Intronic
1131787894 15:95932840-95932862 TGGTGATAGGCAATGACTAATGG - Intergenic
1131883275 15:96881480-96881502 TGATGGCAGTCAGTGATCCAGGG - Intergenic
1132041284 15:98526218-98526240 ATGGGACAGGCAGTGACCGAGGG - Intergenic
1132332417 15:101022035-101022057 TGGAGACAGTTGGTGACCCATGG + Intronic
1133573492 16:7064964-7064986 TGGTGACACACAGGGAGCCAAGG - Intronic
1133815640 16:9195333-9195355 TGCTGCCCGGCAGGGACCCAGGG + Intergenic
1134674519 16:16080173-16080195 CAGTGACAGGCAGAGACGCAAGG - Intronic
1135051430 16:19196082-19196104 AGGTCACAGGGAGGGACCCAAGG + Intronic
1135829941 16:25764096-25764118 TGGTCCCAGGCAGTGATGCAGGG + Intronic
1137636266 16:49989314-49989336 TGGTGGCTGCCAGTGACCAAAGG + Intergenic
1137719062 16:50617102-50617124 TGGCAAATGGCAGTGACCCAGGG - Intronic
1137819834 16:51433585-51433607 GGGTGACAGGCGTTGAGCCACGG + Intergenic
1138694203 16:58796423-58796445 TGGTGCCAGTCCGTGGCCCAGGG - Intergenic
1139570281 16:67807141-67807163 TGCTGGCAGGCCATGACCCACGG - Exonic
1140892174 16:79294439-79294461 TGGAGACAGTGACTGACCCAAGG - Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1144789336 17:17848695-17848717 TGGTGCCAGGCCCTGAGCCATGG - Intronic
1144855869 17:18267514-18267536 TGGTGATAGGAAGTGAGCCCTGG - Intergenic
1144995252 17:19263683-19263705 ATGTGCCAGGCACTGACCCAGGG - Intronic
1147446282 17:40477150-40477172 AGGTGCCTGGCGGTGACCCACGG - Exonic
1147650302 17:42058246-42058268 TGGTTACAGGCAGTAAGGCAGGG - Intronic
1147973897 17:44236790-44236812 GTGTGACAGGATGTGACCCAGGG - Intergenic
1148464283 17:47855730-47855752 AGGTGACAGGCAGTGCCAAAGGG + Intronic
1148817763 17:50342923-50342945 TCCTGACAAGCAGGGACCCAGGG + Intergenic
1150477522 17:65486305-65486327 TGCTGACTGGGAGGGACCCAAGG + Intergenic
1151193502 17:72415598-72415620 TGGGGCCAGGCTGTTACCCAAGG + Intergenic
1152228276 17:79102599-79102621 GGGTGTCAGGGAGGGACCCAGGG + Intronic
1152339577 17:79716656-79716678 TGGTGACAGGCAAGGGCACAGGG + Intergenic
1152927528 17:83094216-83094238 TGGGGACAGGGAGTGAGCAAAGG - Intronic
1153049139 18:884757-884779 TCGTAACAGACAGTGGCCCATGG - Intergenic
1153647456 18:7207976-7207998 TGGTGACAGGTTCTGCCCCATGG + Intergenic
1154385152 18:13886559-13886581 TGGGGTCAGGCAGTGACCCAGGG - Intronic
1157586376 18:48803970-48803992 TGGGGACAGGCTGTGTCCTAGGG + Intronic
1157748661 18:50159482-50159504 TAGTGACATTCAGTCACCCACGG + Intronic
1158482336 18:57832805-57832827 TGGTGATAGGAAGTGACCTAGGG - Intergenic
1158524943 18:58204649-58204671 TGGTGACAGGTCATGACGCATGG + Intronic
1158607991 18:58912873-58912895 TAGAGAGAGGCAGTGAACCATGG + Intronic
1159393770 18:67830284-67830306 GGGTGGGAGGCAGTGACCAAAGG + Intergenic
1159648025 18:70942969-70942991 GGGTGCCAGGCAGAGTCCCAAGG + Intergenic
1163304860 19:16471737-16471759 AGGTGACAGGCCGGGACCCGCGG - Intronic
1163375682 19:16928850-16928872 TGGTGCCAGGCTTTGATCCAGGG - Intronic
1164404389 19:27930503-27930525 TATTGACATGCAGTGACCCCTGG + Intergenic
1166045345 19:40226615-40226637 TGGTGAGAGGCAGGGACCAGGGG - Exonic
1166267951 19:41696598-41696620 TGGTGACAGGCAGTGACCCAGGG + Intronic
1167134311 19:47608301-47608323 GGGTGACAGGCCGGGACCCCAGG - Intronic
926213650 2:10890188-10890210 TGGTGAATGGCAGGGATCCATGG - Intergenic
926843515 2:17108013-17108035 TGGTGACAGGCAGTCAAGGAAGG + Intergenic
929052378 2:37849021-37849043 TAGTCAGAGGCAGTCACCCAGGG + Intergenic
929226565 2:39516898-39516920 TGCTGACAGCCAGAGACCCAAGG - Intergenic
929783165 2:44970946-44970968 TGGTGACAGGCAGAGACAAGGGG - Intergenic
930344922 2:50168151-50168173 TGATGGCAGGCAGTGACCCAGGG + Intronic
930641780 2:53860254-53860276 TGATGGCACGCAGGGACCCAGGG + Intergenic
931771334 2:65500636-65500658 TGGTGACATGCACTAAGCCAAGG - Intergenic
931906811 2:66851491-66851513 TGGAGACAGGCTGTGAATCAGGG + Intergenic
935495807 2:103780291-103780313 TGGTCACAGACAGTGAGGCATGG - Intergenic
935726439 2:106028130-106028152 TAGTCACATCCAGTGACCCATGG - Intergenic
937866383 2:126754384-126754406 TGGTAACTGGCAGTGCCACAGGG + Intergenic
938240485 2:129739097-129739119 TAGTGCCAGGCTGTGGCCCAGGG + Intergenic
938563054 2:132491545-132491567 TGGTGGCATGCAATGACCAAAGG + Intronic
941706323 2:168662393-168662415 TGGAGACAGGCAGTGTCTGAAGG + Intronic
946334347 2:219027564-219027586 GGGTGGCAGGAAGTGACCGAGGG - Intronic
946440857 2:219693962-219693984 TGGTGACAGGAAGAGAAGCAAGG + Intergenic
946904640 2:224404833-224404855 GGGTGGAAGGCAGTGACCAAAGG - Intergenic
948509763 2:238455982-238456004 TGGGGACAGGCAGTGACAAATGG + Intergenic
1171382045 20:24741712-24741734 TTGTGAGAGGTAGTGTCCCAGGG + Intergenic
1172625530 20:36344588-36344610 TGGGGACAGGTAGGGAGCCATGG - Intronic
1175052350 20:56167150-56167172 TTGTGAAAGGCAGTGAACCTGGG + Intergenic
1175502605 20:59461088-59461110 TAGTGACAGGCTTTGATCCATGG + Intergenic
1175525193 20:59628937-59628959 TGGTGCCAACCAGTGAACCATGG - Intronic
1175976117 20:62711246-62711268 TGGTGGCAGGCAGTGAGTCAGGG + Intronic
1177191971 21:17862001-17862023 TGGTGACAGACATTAACACATGG + Intergenic
1179631297 21:42680212-42680234 TGGCGACTGTCAGTGAGCCAGGG - Intronic
1179638436 21:42730862-42730884 TGTTCACAAGCACTGACCCAGGG - Intronic
1180850678 22:19018514-19018536 TGGTGACAGGAAGCCTCCCATGG + Intergenic
1181030673 22:20147679-20147701 TGGTGGCAGGCAGAGGCCAATGG - Exonic
1181512642 22:23395706-23395728 TGGTGGCAGGCAGGGGCCAATGG + Intergenic
1184143940 22:42597264-42597286 TGTTTACAGGCACTGACCCAGGG + Intronic
1184274869 22:43404458-43404480 TGGTGAGAGGCACTTTCCCAAGG - Intergenic
1184339937 22:43880636-43880658 TGCTGACAGGCTGCGCCCCAAGG + Exonic
1184649393 22:45912723-45912745 TGGGGACAGGAGGGGACCCAGGG + Intergenic
1185032543 22:48452098-48452120 GGGTGACAGGCAGGGGCCCGTGG - Intergenic
1185231359 22:49686022-49686044 TAGTGACAGACAGTAAACCATGG + Intergenic
952407320 3:33016062-33016084 AGGTGAGAGCCAGTGCCCCAAGG + Intronic
952847549 3:37701062-37701084 GGGTGACAGACAGTGGACCAAGG + Intronic
952886548 3:38015931-38015953 TGGTGACAGACGGGGACACAGGG + Intronic
953496137 3:43388404-43388426 GGGTGACAGGCTGTGGCCCTGGG + Intronic
953666768 3:44931115-44931137 TGTTGTCAGGCACTGTCCCAAGG - Intronic
953993627 3:47502889-47502911 TGGTGAGTGGCAGTGGCCTAAGG + Intronic
954364022 3:50136902-50136924 TCCTGACAGGCAGTGACCCAGGG - Intergenic
954879034 3:53821535-53821557 TGGTGGCAGTCAGTGATCCTTGG - Intronic
958741701 3:98081452-98081474 TGATGACAAGAAATGACCCAAGG + Intergenic
959181672 3:102987862-102987884 TAGTACCAGTCAGTGACCCAGGG + Intergenic
959546139 3:107598965-107598987 TGGCCCCAGGCAGTGACCCTGGG + Intronic
959560552 3:107774852-107774874 TGCTCACAGGCACTTACCCAAGG - Exonic
961505116 3:127365521-127365543 TGGGGCCAGCCAGGGACCCAAGG - Intergenic
961640635 3:128362673-128362695 TGGTGAGAATCAGTGACACATGG - Intronic
963072573 3:141316826-141316848 TGGTGAGAGGGAGGGACCCTGGG - Intergenic
964869871 3:161301920-161301942 TGGTGGCAGGCTGGGACTCAGGG + Intergenic
969108395 4:4825646-4825668 GGCTGACATGCAGAGACCCAGGG - Intergenic
972790499 4:42367138-42367160 TGGAGGCAGGCAGTGTCCCTTGG + Intergenic
974030776 4:56774326-56774348 TGGAGAAAGGCTGTGACCCTTGG - Intergenic
976897571 4:90129400-90129422 CCGTGACAGGCACTGTCCCAAGG - Intronic
977317720 4:95471560-95471582 TGTTGACAGGCAGTGAGTCTTGG - Intronic
977886019 4:102252434-102252456 TGGGGACAGGGAGTGGCCCAGGG + Intronic
979011949 4:115382962-115382984 TGGTGTCAGTCTGTGGCCCAGGG + Intergenic
979522530 4:121685431-121685453 TTGTGAAAGGCAGTGACGAAAGG + Intronic
982247379 4:153366771-153366793 TTGTGCCTGGCAGTGAACCATGG + Intronic
982713740 4:158784807-158784829 TGGTACCAGTCCGTGACCCAGGG + Intronic
990697798 5:58441481-58441503 TAATGACAGTCAGTGACACAAGG - Intergenic
993960128 5:94287814-94287836 TGGTGCCAGGCTGTGTCACAAGG + Intronic
998038890 5:138938264-138938286 TGGTGACGGGCAGGGAACCGTGG - Intergenic
999259289 5:150228099-150228121 GGGTGACGGGCAGGGCCCCAGGG - Intronic
999270752 5:150295169-150295191 TGGTCACAGGCAGTAAGCCTCGG + Intergenic
1000213347 5:159130624-159130646 AGGTGACAGGCACTGACCAGTGG - Intergenic
1000966905 5:167668452-167668474 TGCAAACAGGGAGTGACCCAAGG - Intronic
1001945818 5:175777159-175777181 TGGTGGCAGGCGGAGCCCCAAGG - Intergenic
1004635137 6:17460181-17460203 TGGAGAGAGAAAGTGACCCAAGG + Intronic
1006076071 6:31533289-31533311 TGATGGGAGGCAGTGACTCAAGG + Intronic
1006393735 6:33773616-33773638 TGGTGACAGGTCCTGACCCCTGG - Intronic
1006626961 6:35404492-35404514 TGGGGACAGTCAGTGTGCCAGGG - Intronic
1007480338 6:42145616-42145638 TGGAGACAGGCAGTGACCTGTGG + Intergenic
1007685583 6:43665554-43665576 GGGTGAGCTGCAGTGACCCAAGG + Intronic
1015524861 6:134166592-134166614 ATGTGACAGGCAGTGAACAAGGG - Intergenic
1015610562 6:135013275-135013297 TGGTGACTGGCAGAGACCCACGG - Intronic
1015953999 6:138581765-138581787 TGTTGAGAGGCAGTGACACTGGG + Intronic
1017970226 6:159305997-159306019 TGGTGACAGGCTGCTAGCCAGGG + Intergenic
1018206954 6:161445292-161445314 TGGTGCTCGGCACTGACCCAGGG + Intronic
1018494571 6:164336957-164336979 TGGTGACAGGAACTGAGCAAAGG - Intergenic
1020308933 7:6854942-6854964 TGGTGAGAGGCCCTGACCTAGGG - Intergenic
1020434084 7:8143575-8143597 AGGTCACAGGCAGAGAGCCAGGG + Intronic
1023381996 7:39617670-39617692 TAGTGACAGGGACTGACCAAAGG + Intergenic
1024048307 7:45600267-45600289 TAGTGACATGAAGTGACCCATGG + Intronic
1026950259 7:74342042-74342064 TCGTGCCAGGCAGAGACCCATGG + Intronic
1027150513 7:75730257-75730279 GGGTGCCAGGCAGTGACAGAAGG + Intronic
1032439726 7:131933224-131933246 AGGGGACATGCAGTGGCCCACGG - Intergenic
1033760314 7:144430211-144430233 TGGAGGCAGGCAATGACACAGGG - Intergenic
1034051270 7:147986709-147986731 TGTTGATAGGCAGAGACCCAAGG - Intronic
1034265137 7:149777091-149777113 TGGTTTCAGGCAGAGAACCAGGG + Intergenic
1036757972 8:11484014-11484036 TGATGACAGGCATTGCTCCATGG - Intergenic
1037019547 8:13952386-13952408 TGGTGTCAGTCAGTCACCAAAGG + Intergenic
1037736284 8:21569567-21569589 GTGTGACAGGCAGTGAGCTAAGG - Intergenic
1040328470 8:46374208-46374230 TGGTGACCGGCAGAAACTCAGGG - Intergenic
1040530941 8:48265794-48265816 TGGTGAGAAGCAGTGAGACATGG + Intergenic
1040546349 8:48401065-48401087 TGGTGAAAGGCGGGGACCCAGGG + Intergenic
1041727570 8:61032213-61032235 TGGGGACAGGCAGGGCACCAGGG + Intergenic
1042852045 8:73226229-73226251 TGGTGATGGGCAGTGACACATGG + Intergenic
1043083833 8:75801847-75801869 TGAGGACAGGCAGAGACACAGGG + Intergenic
1043856620 8:85272525-85272547 GGATTACAGGTAGTGACCCATGG + Intronic
1046057465 8:109095923-109095945 CAGTGAGAGGCAGTGAACCAGGG - Intronic
1046808872 8:118510627-118510649 TGGTCACAGTCAGTGAGCAAAGG + Intronic
1047425297 8:124739847-124739869 TGGCTCCAGGCAGTGACTCAAGG + Intergenic
1047996101 8:130337871-130337893 TAGTGACAGCCAGTTCCCCATGG + Intronic
1049816799 8:144607368-144607390 TGGTGACGGGGAGGGACCCACGG + Intergenic
1049824894 8:144662146-144662168 TGGGGAGAGAAAGTGACCCAGGG - Intergenic
1050127673 9:2376083-2376105 TGGTACCAGTCAGTGGCCCAGGG + Intergenic
1050615920 9:7401600-7401622 TGCTGACCAGCAGTGAGCCAGGG + Intergenic
1051819633 9:21149633-21149655 TGTAGACAGGCAGTGTCCCTGGG + Intergenic
1056672933 9:88646771-88646793 TGGTGAAAAGCTGTGCCCCAAGG + Intergenic
1057026905 9:91740912-91740934 TGCTGCCAGGCACTGATCCAAGG + Intronic
1057644293 9:96858675-96858697 TCGTGACAGGCAGTGGCGCGAGG + Intronic
1057903544 9:98967381-98967403 TCCTGACAGGCCTTGACCCAGGG + Intronic
1060896146 9:127218843-127218865 TGGGCACAGGCTGTGAGCCAGGG + Exonic
1061463186 9:130756946-130756968 AGATGACAGGCAGTGCCCTAAGG - Intronic
1061902694 9:133681061-133681083 TGCCGACAGCCAGTGGCCCAGGG - Intronic
1062143905 9:134978482-134978504 TGTTGACGGGCAGGGCCCCACGG - Intergenic
1062708324 9:137957423-137957445 TGGGGACTGGGAGGGACCCAAGG + Intronic
1188026106 X:25210759-25210781 TGGAGTCAGGCAGTGTACCAGGG + Intergenic
1190641652 X:52486014-52486036 TGGTGAAAGGCAATTATCCAGGG - Intergenic
1190646020 X:52526851-52526873 TGGTGAAAGGCAATTATCCAGGG + Intergenic
1190739609 X:53280520-53280542 TGGTGACAGGATGGGACTCAGGG + Intronic
1192544762 X:72004390-72004412 AGGGGACAGGCAGTGACCAGGGG + Intergenic
1192709795 X:73567891-73567913 TGGTGACATACAGAGAGCCAGGG - Intronic
1197206914 X:123798596-123798618 TGGTGCCAGGCTGTGAGCCAAGG + Intergenic
1197209225 X:123815615-123815637 TGGTGCCAGGCTGTGAGCCAAGG - Intergenic
1201702227 Y:16896585-16896607 TGGTGACAAACAGTGACCTATGG - Intergenic