ID: 1166268005

View in Genome Browser
Species Human (GRCh38)
Location 19:41696840-41696862
Sequence CCCGGCCATCTGGTTCTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 62}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166268005_1166268017 6 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268017 19:41696869-41696891 ATGGAGAAGGAGCAGGACAGGGG 0: 1
1: 0
2: 9
3: 92
4: 932
1166268005_1166268016 5 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268016 19:41696868-41696890 GATGGAGAAGGAGCAGGACAGGG 0: 1
1: 1
2: 21
3: 756
4: 2469
1166268005_1166268015 4 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268015 19:41696867-41696889 AGATGGAGAAGGAGCAGGACAGG 0: 1
1: 0
2: 11
3: 198
4: 1370
1166268005_1166268018 15 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268018 19:41696878-41696900 GAGCAGGACAGGGGATCCCCAGG 0: 1
1: 0
2: 4
3: 32
4: 272
1166268005_1166268014 -1 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268014 19:41696862-41696884 GGTTCAGATGGAGAAGGAGCAGG 0: 1
1: 0
2: 2
3: 50
4: 534
1166268005_1166268019 20 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268019 19:41696883-41696905 GGACAGGGGATCCCCAGGATAGG 0: 1
1: 0
2: 0
3: 22
4: 198
1166268005_1166268012 -7 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268012 19:41696856-41696878 GGCCGGGGTTCAGATGGAGAAGG 0: 1
1: 0
2: 3
3: 17
4: 225
1166268005_1166268020 23 Left 1166268005 19:41696840-41696862 CCCCATAGAACCAGATGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1166268020 19:41696886-41696908 CAGGGGATCCCCAGGATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166268005 Original CRISPR CCCGGCCATCTGGTTCTATG GGG (reversed) Intronic
900432309 1:2608113-2608135 CCCAGCCTTCTGTTTCCATGGGG + Intronic
910553884 1:88507913-88507935 CCCGGCCATCTTGTCCCATCTGG - Intergenic
914745615 1:150498982-150499004 CCCGGCCATCTGGCTTCCTGGGG + Exonic
916491753 1:165308248-165308270 CCCTGGCATCTGGTTCTCAGAGG - Intronic
918568879 1:185963382-185963404 CCCGGCAATCTTGCTCCATGTGG - Intronic
920078819 1:203357203-203357225 CCCAGCCATGTGGAACTATGAGG - Intergenic
922564230 1:226590758-226590780 CCTGGCCATCTGGAGCTAAGCGG - Intronic
1063942569 10:11145488-11145510 CCCCACCAACTGGTTCTGTGCGG - Intronic
1066109409 10:32182866-32182888 AACGGCCATCTGGTTCTGTTGGG + Intergenic
1072822865 10:98575316-98575338 CACGGCCATGTGGTGCTGTGTGG - Intronic
1077101559 11:824774-824796 CCCGGCCAGCTGGTGCTGCGGGG - Exonic
1077995387 11:7448251-7448273 CAGAGCCATCTGGTTCTATCTGG + Intronic
1080181029 11:29426486-29426508 CTAGGCCTTCTGGTCCTATGAGG - Intergenic
1083353102 11:62045055-62045077 CCAGGCCATCTGGATGTATACGG + Intergenic
1088935871 11:114400088-114400110 CCCGGCCATCTGGTTCCCTTGGG + Exonic
1104715392 12:131012870-131012892 CCCAGCCGTCTGCTTCTGTGTGG - Intronic
1109424748 13:62154661-62154683 CCTGGCCATCTCGCTCTATCTGG - Intergenic
1113791477 13:113030815-113030837 CCCGGCCATGTGGTTCTAAGGGG - Intronic
1114597126 14:23922775-23922797 CTCTGCCCTGTGGTTCTATGTGG - Intergenic
1131046273 15:89318494-89318516 CCTGGCCATGTGCTCCTATGTGG - Intronic
1131515592 15:93074200-93074222 CCTGCCCATCTGGTTCTTTGGGG + Intronic
1132019536 15:98348444-98348466 CCCGGCCAACTGATTCTCTCTGG - Intergenic
1136037247 16:27549707-27549729 CCCGGGCATCAGCTTCTATGAGG - Exonic
1151683716 17:75634960-75634982 CCCGGCTGTTTGGTTCTTTGGGG + Intronic
1152044365 17:77926107-77926129 CCATGCCATGTGGTCCTATGAGG - Intergenic
1153049411 18:887169-887191 CCCTGCCATCTGATTAAATGAGG - Intergenic
1160103230 18:75944095-75944117 CCCTGCAATCTGCCTCTATGTGG + Intergenic
1160812701 19:1019859-1019881 CCCGGCCAGCTTGTTTTCTGAGG + Intronic
1166268005 19:41696840-41696862 CCCGGCCATCTGGTTCTATGGGG - Intronic
931748330 2:65309807-65309829 CCTGTCCGTCTGGTTCTCTGGGG - Intergenic
935205392 2:100892491-100892513 TCTAGCCATCTGGCTCTATGAGG + Intronic
939696767 2:145335545-145335567 CCTGGCCATTTGGTTCTAGATGG - Intergenic
941745368 2:169081221-169081243 CACGGCCAGCTGGAGCTATGTGG - Intronic
942483690 2:176417205-176417227 CCCTGCCTTCTGTTTCTATTTGG - Intergenic
1171161773 20:22931940-22931962 CCCGGCCTTTTTGTTCTATTTGG + Intergenic
1184875378 22:47271041-47271063 CCAGTCCGTCTGGTTCCATGTGG + Intergenic
1185136888 22:49078434-49078456 CCCGGCCAGCAGGCTCTCTGAGG + Intergenic
1185292318 22:50033254-50033276 CCTGACCATCTGGTTCTACAAGG - Exonic
949562017 3:5211939-5211961 TCCTGCCCTCTGTTTCTATGTGG - Intronic
952525414 3:34205471-34205493 CCCAGCCAGGTGTTTCTATGAGG - Intergenic
957523276 3:81348666-81348688 CCTGGTGATCTGGTTCTATTTGG - Intergenic
960949036 3:122987111-122987133 CCAGCCCATCTGGCTCCATGGGG - Intronic
961573392 3:127816476-127816498 CCCAGCCATCTGGATCCATCCGG - Intronic
968685902 4:1958420-1958442 CCCCGCCATCTTGCTCTCTGAGG - Intronic
969360225 4:6658670-6658692 CCGGGCCACCTGGGTCTTTGCGG - Intergenic
975311965 4:72913416-72913438 CCTGGCCATCTGGGTTTGTGAGG - Intergenic
976837919 4:89396867-89396889 CCCTGCCACCTGAATCTATGGGG - Intergenic
979612034 4:122699560-122699582 CCAGGTCATCTGGTTCTACAGGG - Intergenic
994642772 5:102430803-102430825 CCTGCCCATCTCATTCTATGAGG - Intronic
1007959542 6:45946578-45946600 CCTGGCCTTCTGGTTCTCTAGGG - Intronic
1015763999 6:136696363-136696385 ACCGGGAATCTGGCTCTATGGGG - Intronic
1023255936 7:38311886-38311908 CCCAGCCATCTGGTACAATCTGG - Intergenic
1029751198 7:102543591-102543613 CCCGGCCATAGGGCTCTCTGCGG - Intronic
1029769150 7:102642696-102642718 CCCGGCCATAGGGCTCTCTGCGG - Exonic
1030142673 7:106320910-106320932 CCCGGCCACCTGGCCATATGAGG - Intergenic
1034345476 7:150382801-150382823 CCCGGCCTCCTGGCTCGATGAGG + Intronic
1036190330 8:6664277-6664299 CCAGGCCATCTATTTTTATGTGG - Intergenic
1043074101 8:75674180-75674202 CCCTGCCTTTTTGTTCTATGTGG - Intergenic
1043518771 8:81021096-81021118 CCCTGCCATCTGTTTCTGTAGGG - Intronic
1049720333 8:144112645-144112667 CCTGGCCCTCTGGTTGTAGGTGG - Intronic
1050479394 9:6074084-6074106 CCAGGTTATCTGATTCTATGAGG + Intergenic
1050585789 9:7110013-7110035 CCCAGCCATGTGGAACTATGAGG + Intergenic
1062541954 9:137045557-137045579 CGCGGCCATCTGGCTCTGGGCGG - Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1190069277 X:47266200-47266222 CATGGCCATCTGGTTTAATGGGG - Intergenic
1191952722 X:66610940-66610962 CCCAGCCACCTGTTCCTATGTGG - Intronic
1192202969 X:69078554-69078576 CCCGGCCAGCTGGTTCTACATGG + Intergenic
1196647153 X:118130471-118130493 CCCAACAATCTGGTTCTATAAGG - Intergenic