ID: 1166268201

View in Genome Browser
Species Human (GRCh38)
Location 19:41697635-41697657
Sequence CCACATGTATTGTACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166268201_1166268206 -5 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268201_1166268211 19 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268211 19:41697677-41697699 GAAGCCAGTTCTCTCTTCCTAGG 0: 1
1: 0
2: 1
3: 21
4: 224
1166268201_1166268207 -4 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268201_1166268214 27 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268214 19:41697685-41697707 TTCTCTCTTCCTAGGAGACCGGG 0: 1
1: 0
2: 0
3: 25
4: 244
1166268201_1166268213 26 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268213 19:41697684-41697706 GTTCTCTCTTCCTAGGAGACCGG 0: 1
1: 0
2: 1
3: 24
4: 217
1166268201_1166268208 -3 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268208 19:41697655-41697677 TGGGGACAGTCTGTACCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166268201 Original CRISPR CCACATGTATTGTACCTGCA GGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
907395154 1:54184542-54184564 ACTCATTTATGGTACCTGCATGG - Intronic
916274103 1:162975268-162975290 ACACATCTCTTGTACCTCCATGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064338591 10:14466873-14466895 ACAAATGTAATGTTCCTGCAGGG - Intergenic
1064993787 10:21278913-21278935 CCCCTTGTATTGTATGTGCATGG + Intergenic
1070810101 10:79293305-79293327 CCACATGCATTGAAAGTGCAGGG - Intronic
1076612388 10:131734400-131734422 CCATATGAATTGTGCCTGAATGG - Intergenic
1079153001 11:17918382-17918404 CCAGATGTATTGACCCTGCAGGG - Intronic
1079625997 11:22618274-22618296 CCACATGTTGGGTACCAGCAAGG - Intergenic
1102709626 12:114914736-114914758 CTACATGCCTTGTATCTGCAGGG + Intergenic
1110232213 13:73178853-73178875 CCACATGTGTGGTGTCTGCAGGG - Intergenic
1119878840 14:78083877-78083899 TTATGTGTATTGTACCTGCATGG + Intergenic
1121713696 14:96057789-96057811 CCTCCTGCATTGTACCTGGAAGG + Intronic
1123826067 15:24083509-24083531 TCACAGGTATGGTACCTGCTAGG - Intergenic
1125182753 15:36896095-36896117 TCACATGTATTTTAGCAGCATGG + Intronic
1125388744 15:39168818-39168840 GCACCTGTATTTTATCTGCATGG + Intergenic
1128647042 15:69385230-69385252 CTACATCTACTGTATCTGCATGG - Intronic
1129527681 15:76231240-76231262 CTACATGCATTGTAACTACATGG + Intronic
1129732650 15:77940826-77940848 CCACAAGGATTGGACTTGCAGGG + Intergenic
1137879870 16:52034855-52034877 TCACCTGTATTGGACCTCCAGGG + Exonic
1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG + Intronic
1149622829 17:58059107-58059129 CCACATGAATATTACCTGCTTGG + Intergenic
1150145936 17:62769505-62769527 GCACAAGAATTGAACCTGCAGGG - Intronic
1155931524 18:31713773-31713795 TCCCATGTATTTTACCTGCCTGG - Intergenic
1157788420 18:50507540-50507562 GCACATGTATTGTTGCTGAAGGG - Intergenic
1158785152 18:60702681-60702703 CCACATGCATTGTAGTGGCAGGG + Intergenic
1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG + Intronic
1159156219 18:64586738-64586760 CCTCATGTATTCTAGCTACAAGG - Intergenic
1159353060 18:67299888-67299910 CCACATGGATTGTCCCTACATGG - Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1167961513 19:53108288-53108310 CCACATTTATTATACTTGTATGG + Exonic
1168397172 19:56058232-56058254 CCACATGCCTTCAACCTGCAGGG - Exonic
926674222 2:15606259-15606281 ACTCAGGTATTATACCTGCAAGG + Exonic
926799320 2:16645552-16645574 CCACATGTATTCTACCTTCAAGG + Intronic
928395629 2:30941392-30941414 TGACATGTATTATGCCTGCATGG + Intronic
929570727 2:43021410-43021432 CCACAGGCATTATTCCTGCAGGG + Intergenic
931917301 2:66970083-66970105 CCACACCTATGGTACCTACAAGG - Intergenic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
938612836 2:132966772-132966794 ACACATGTATTTTATCTGTAGGG + Intronic
938942379 2:136180564-136180586 CCTTAAGTATTGTACCAGCAAGG + Intergenic
939172167 2:138709058-138709080 ACACATGTATTCTAGCAGCAGGG + Intronic
940046053 2:149410830-149410852 TCAGATGTATTGTACTTGCCTGG - Intronic
941866278 2:170337997-170338019 CAACATGGATTTTAACTGCATGG - Intronic
942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG + Intergenic
947405074 2:229767225-229767247 CCACATTTATTGTTCCAGCCTGG + Intronic
1169611550 20:7386143-7386165 CCTCATTTCCTGTACCTGCAGGG - Intergenic
1169717441 20:8636160-8636182 GCACATGTATTCTACCTGCAAGG - Intronic
1173402269 20:42736203-42736225 GCCCATGTATTTTCCCTGCAGGG - Intronic
1174639407 20:52030409-52030431 CCAAATGTACTGTACCAGCCTGG - Intergenic
1177946159 21:27472094-27472116 CCAAATATATTGTAGCTGCATGG + Intergenic
1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG + Intergenic
1180867867 22:19129809-19129831 CCTCCTGTCTTGCACCTGCAGGG + Intergenic
1181979445 22:26755669-26755691 CTACCTGTCTTCTACCTGCAGGG - Intergenic
1182073823 22:27481203-27481225 CCACATATATTGGCCCTGCTTGG - Intergenic
1183170065 22:36181183-36181205 CCACAGGAATGGTACCTGTAGGG - Intergenic
949179204 3:1106817-1106839 TCACATGTATTTTTACTGCATGG + Intronic
950250285 3:11459557-11459579 CAACATGAATTGTAACTTCATGG + Intronic
958185229 3:90111212-90111234 CCTCATCTCTTGTACCTGCTAGG - Intergenic
961906888 3:130272227-130272249 CCAGATGTACTGTACCCACAGGG - Intergenic
964513233 3:157476674-157476696 GCTCATGTATTCTACCTGCAGGG - Intronic
965088917 3:164137744-164137766 CCACATGTATTATACCACAAAGG + Intergenic
970124371 4:12792705-12792727 CCACATGTTTTTTCCCTGAAGGG + Intergenic
971654546 4:29326270-29326292 TCACATGTATTGTAATTGCAGGG + Intergenic
978153982 4:105468792-105468814 CCTCATGCATTAGACCTGCATGG + Intronic
980221753 4:129926810-129926832 CCCTATGTACTGTACATGCAGGG + Intergenic
983580695 4:169306990-169307012 CCACTTGCATTGCACCTGAAAGG - Intergenic
985590310 5:761194-761216 CCTCCTGTATTGCACCTTCATGG - Intronic
986226639 5:5821729-5821751 CTACATATATTGTCACTGCAGGG - Intergenic
987539117 5:19230706-19230728 CAACATGCATGCTACCTGCAGGG + Intergenic
990715351 5:58630217-58630239 CCAAATATATTTTGCCTGCAAGG - Intronic
991998061 5:72407948-72407970 CCACATGGATGGGACCTGTAGGG + Intergenic
994795981 5:104300220-104300242 CCACAGCGATTCTACCTGCATGG - Intergenic
995245757 5:109933466-109933488 ACACGTGTAATGTATCTGCAAGG + Intergenic
997628109 5:135345101-135345123 CCACTTCTGTTTTACCTGCAAGG - Intronic
1005313078 6:24577623-24577645 CTACATGTCTTTTCCCTGCAAGG - Intronic
1008092183 6:47305203-47305225 CCATACGAATTGTACCTTCATGG + Intronic
1008899041 6:56590541-56590563 CCCCATGTATTGTATATTCAAGG - Intronic
1012079923 6:94743698-94743720 CCACATGTCTGGTATCTGCTAGG - Intergenic
1012097540 6:94982440-94982462 TTACATCTATTGTACCTGTATGG - Intergenic
1012621584 6:101351157-101351179 ACACATGTATTGAAGTTGCATGG + Intergenic
1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG + Intergenic
1018698179 6:166406678-166406700 ACACAGTTATTGTACCTGAAAGG + Intergenic
1022203807 7:28143494-28143516 CCAAAGGTTGTGTACCTGCATGG - Intronic
1023279544 7:38555470-38555492 CCTCATTGATGGTACCTGCAAGG + Intronic
1023330507 7:39110411-39110433 TCACATTTATTGCATCTGCATGG + Intronic
1027680276 7:81211785-81211807 CCACATGTATTGCACATGAGTGG + Intergenic
1028230868 7:88305321-88305343 CTGCATGTATTCTACCTGCATGG - Intronic
1030480948 7:110102939-110102961 CCACATATCAAGTACCTGCAGGG - Intergenic
1031043100 7:116859464-116859486 CCACATGTATTGTATCACTAAGG + Intronic
1039608800 8:38902744-38902766 TGACATGTATTATACATGCAAGG + Intronic
1045852596 8:106720631-106720653 CAACATCAATTGTATCTGCATGG - Intronic
1046336688 8:112798980-112799002 CAACTTGTATTTTACATGCAGGG - Intronic
1047859274 8:128946828-128946850 ACAAATGTATTGTTCTTGCAGGG - Intergenic
1048479909 8:134779862-134779884 CCACATTTATCCTACCTTCAGGG - Intergenic
1049256597 8:141617391-141617413 CCACATGTGTTGAGCCTGCTTGG - Intergenic
1054875598 9:70093396-70093418 CCACATGTATTTTAAATACAGGG + Intronic
1055693563 9:78859074-78859096 CCACATGTATACTACCTGCCTGG + Intergenic
1056568360 9:87794699-87794721 CAACATGAATTGTTTCTGCAGGG + Intergenic
1185919323 X:4072053-4072075 CCACATTTTTAGTACATGCATGG - Intergenic
1190581345 X:51894859-51894881 CCACATGTTTAGTACCCGCCTGG + Intronic
1195067581 X:101251545-101251567 TAACATCTATTGTATCTGCATGG - Intronic
1196253182 X:113485940-113485962 CCAGATGTATTGGAGCTGCTTGG + Intergenic
1196772060 X:119304090-119304112 CTCCATGTCTTCTACCTGCAAGG + Intergenic