ID: 1166268206

View in Genome Browser
Species Human (GRCh38)
Location 19:41697653-41697675
Sequence TGTGGGGACAGTCTGTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 167}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166268203_1166268206 -6 Left 1166268203 19:41697636-41697658 CCTGCAGGTACAATACATGTGGG 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268199_1166268206 1 Left 1166268199 19:41697629-41697651 CCCAGACCCTGCAGGTACAATAC 0: 1
1: 0
2: 0
3: 15
4: 102
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268195_1166268206 8 Left 1166268195 19:41697622-41697644 CCCCAGCCCCAGACCCTGCAGGT 0: 1
1: 0
2: 7
3: 95
4: 621
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268191_1166268206 27 Left 1166268191 19:41697603-41697625 CCCTGAAACCACAACAAAACCCC 0: 1
1: 0
2: 1
3: 19
4: 340
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268196_1166268206 7 Left 1166268196 19:41697623-41697645 CCCAGCCCCAGACCCTGCAGGTA 0: 1
1: 0
2: 5
3: 40
4: 350
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268200_1166268206 0 Left 1166268200 19:41697630-41697652 CCAGACCCTGCAGGTACAATACA 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268197_1166268206 6 Left 1166268197 19:41697624-41697646 CCAGCCCCAGACCCTGCAGGTAC 0: 1
1: 0
2: 3
3: 38
4: 393
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268201_1166268206 -5 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268193_1166268206 19 Left 1166268193 19:41697611-41697633 CCACAACAAAACCCCAGCCCCAG 0: 1
1: 0
2: 7
3: 67
4: 673
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268192_1166268206 26 Left 1166268192 19:41697604-41697626 CCTGAAACCACAACAAAACCCCA No data
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167
1166268198_1166268206 2 Left 1166268198 19:41697628-41697650 CCCCAGACCCTGCAGGTACAATA 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166268206 Original CRISPR TGTGGGGACAGTCTGTACCC AGG Intronic
902097976 1:13962170-13962192 TGTGGGAACAGCCTGTGCCGGGG + Intergenic
904478078 1:30777373-30777395 TTTGGGGTCAGTCTGTGGCCTGG - Intergenic
904744685 1:32703265-32703287 TTTGGGGACAGCCTGGAGCCTGG + Intronic
906196270 1:43932474-43932496 TGTGTGGACCAGCTGTACCCTGG - Intergenic
911690605 1:100829654-100829676 TGTGGGGACAACCTACACCCCGG + Intergenic
912712210 1:111958115-111958137 TTTGGGGACAGCCTGTCTCCAGG - Intronic
915943223 1:160132167-160132189 TCAGGGAACAGTGTGTACCCTGG + Intronic
916075127 1:161196237-161196259 TGTGGGCACCGTCTGTGACCCGG - Exonic
917536901 1:175880964-175880986 TGTGGGGACAGGCTCAACCTTGG - Intergenic
918132301 1:181640140-181640162 CTTGGGGACAGTCAGTCCCCAGG - Intronic
919145107 1:193624508-193624530 TGTGGGGTCAGGCTGATCCCAGG - Intergenic
920433626 1:205934798-205934820 TGTGAGGACAGACTGTAACTGGG + Intronic
920819046 1:209363212-209363234 TGTGGGGACAGTGTATGCTCAGG - Intergenic
922488289 1:225993994-225994016 TGGGAGGACAGTTTGAACCCAGG - Intronic
922946840 1:229523631-229523653 TGTGGTGCCAATCAGTACCCTGG + Intronic
1065660955 10:28003878-28003900 CCTGGGGACAGCCTGCACCCAGG - Intergenic
1067068114 10:43114891-43114913 TGTGGGGACAGTCTGTGGGGTGG + Intronic
1067685637 10:48464858-48464880 TGTGGGGCCAGTCTGCAGCCTGG - Intronic
1067837732 10:49652016-49652038 GGTGGAGTGAGTCTGTACCCTGG + Intronic
1067907753 10:50311306-50311328 TGTGGGGACTATCTGTACAGCGG - Exonic
1068142649 10:53026944-53026966 TCTTAGGACAGTCTGTAACCAGG - Intergenic
1068749321 10:60573519-60573541 TGTGGGCACAGTGTGTGGCCAGG - Intronic
1069235386 10:66065117-66065139 GTTGGGGAAAGTCTTTACCCTGG + Intronic
1069278528 10:66624318-66624340 TATGGGGAGAGTCTGAAGCCTGG + Intronic
1069753853 10:70761555-70761577 TGGGGGGCCAGTCTGTAATCTGG - Exonic
1071483586 10:86082785-86082807 AGAGGGGACAATCTGTACACAGG - Intronic
1073432803 10:103497618-103497640 AGTGGGGTCAGTGTGTTCCCAGG - Intronic
1076125463 10:127970484-127970506 TGAGGGGAAGGTCTGTACCTGGG - Intronic
1076553527 10:131304868-131304890 TGTGGGGTGAGTCAGTCCCCAGG - Intronic
1076830548 10:132992284-132992306 TGTGGTGTCAGTCGGTCCCCAGG + Intergenic
1078848192 11:15140669-15140691 TGGGGGGACTGCCTGAACCCAGG - Intronic
1079806157 11:24932963-24932985 TGTGGGCACATTCAGTCCCCAGG - Intronic
1080774239 11:35370973-35370995 CTTTGGGACTGTCTGTACCCTGG - Intronic
1081968773 11:47184970-47184992 TGTGGGGCCTGGCTGCACCCGGG - Intronic
1082854235 11:57792084-57792106 TGAGGGAACAGTCTGTACCCAGG + Intronic
1085533469 11:77204852-77204874 TGTGGGCACAGTATGTACAAAGG - Intronic
1086317544 11:85609854-85609876 TCCTGGGACAGTCTGTAACCAGG + Intronic
1087075142 11:94121541-94121563 TCCTGGGACAGTCTGTAACCAGG + Intergenic
1088452743 11:109999185-109999207 TGTGAGGACAGACTGTACCAAGG - Intergenic
1089365310 11:117917803-117917825 GGTGGGGACAGTCTGAATTCTGG + Intronic
1089560594 11:119341324-119341346 TGTGGGGCCAGTCAGCAGCCTGG + Exonic
1089718946 11:120394303-120394325 GGTGGGGACAGCCTGAGCCCAGG - Intronic
1090211258 11:124922488-124922510 GGTGGGGAGAGTCTGTACCTGGG - Intronic
1091460112 12:637848-637870 GGTGGGGACATTCTGTGCCTAGG - Intronic
1091573747 12:1713759-1713781 TCCTGGGACAGTCTGTAACCAGG - Intronic
1093029890 12:14278769-14278791 TGTGGGGGCAGTAGGTACACGGG - Intergenic
1093210654 12:16304321-16304343 TGAAGGCACAGACTGTACCCTGG + Intergenic
1098521980 12:71442426-71442448 TGTGATGACAGCCTGTACCCTGG + Intronic
1100901520 12:99246472-99246494 TGTGGAGAGAGCCTGTACTCTGG - Exonic
1102961474 12:117096256-117096278 TGTGGGCTCAGTCTGTCCTCTGG + Intronic
1103177042 12:118873167-118873189 TGAGGCCACAGTCTGTATCCAGG - Intergenic
1105027670 12:132859950-132859972 TGGGAGGACAGTCTGAGCCCAGG + Intronic
1107381171 13:39857645-39857667 TCTGGGCACATTCTGTCCCCAGG - Intergenic
1107415118 13:40192957-40192979 TGTGGAGACAGACTGTAACCAGG - Intergenic
1107838981 13:44436318-44436340 TGTGGGGAAAGCCTGTTCTCTGG + Intronic
1110069623 13:71157760-71157782 TGTGGGAGCAATCTTTACCCAGG - Intergenic
1114696663 14:24632566-24632588 TAAGGGGACAGTCGGTCCCCAGG + Intronic
1115364599 14:32543770-32543792 TTTGGGGACAGCCTCTATCCAGG + Intronic
1119423713 14:74522984-74523006 GGTGGGGACAGTCAGTGGCCAGG + Intronic
1119615472 14:76096083-76096105 TGTGGGGACTGACAGTCCCCTGG + Intergenic
1123019484 14:105390999-105391021 TGTGGGGACAGACAGTGCTCAGG - Intronic
1128998017 15:72310992-72311014 TTTGGGGACAGTGTGAACACTGG - Intronic
1130297351 15:82656691-82656713 TGTGGTGACACTTTGTCCCCAGG - Intergenic
1130399625 15:83537298-83537320 TGTGGGTACAGTCTTCAGCCTGG + Intronic
1131119125 15:89812363-89812385 TGCGGGGACAGAGTGTGCCCTGG - Intronic
1132888648 16:2193849-2193871 TGGGGGGACAGTGGGTACCCAGG + Intronic
1133119323 16:3596512-3596534 TGTGGGGACAGACTGTCCCCGGG + Intronic
1133853846 16:9531025-9531047 TTTGGGGACACTCTGTACAGAGG - Intergenic
1135585667 16:23669112-23669134 TGTGGTGACAGGCTGTTCCTAGG - Exonic
1136170510 16:28486534-28486556 TGTGGGGAGAGGCTGTCCCATGG - Intronic
1139931257 16:70528563-70528585 TGGGAGGACAGTTTGAACCCAGG - Intronic
1141029638 16:80576204-80576226 TGTGGGCACCGTCCCTACCCTGG + Intergenic
1141677673 16:85526062-85526084 GGTGGGGACTGTCTGCACCCAGG - Intergenic
1142599631 17:1047322-1047344 TGTGGGGACAGACCGTTCCGTGG + Intronic
1143323413 17:6082495-6082517 CGTGGGGACAGTCTGGCTCCGGG + Intronic
1145158623 17:20559280-20559302 TGTGTGGACTGGCTGTACCATGG + Intergenic
1146672592 17:34751937-34751959 TCTGGGGACAGCCTGTTTCCCGG + Intergenic
1152015002 17:77744736-77744758 TGTGGGGACAGGCAGGAGCCAGG - Intergenic
1158936698 18:62371172-62371194 TGTGGAGACAGACAGGACCCTGG + Intronic
1162237287 19:9319352-9319374 TCTTGGGACAGCCTGTAACCAGG - Intergenic
1163128658 19:15258339-15258361 TTTGGAGACAGTCTTCACCCAGG + Intronic
1163618028 19:18341076-18341098 TGTGGGGACAGGCTGGACCTCGG - Intronic
1165100909 19:33438261-33438283 AGTGGGCACAGCCTGTACCCTGG - Intronic
1165741899 19:38209770-38209792 TGTGAGAACAGCCTGTTCCCAGG - Intergenic
1166268206 19:41697653-41697675 TGTGGGGACAGTCTGTACCCAGG + Intronic
1166337137 19:42115196-42115218 TGTGGAGACACTCTGTAAACTGG - Intronic
1167949446 19:53014692-53014714 TGTGGGGACAGTGTGTGCCTTGG - Exonic
1167954014 19:53049853-53049875 TGTGGGGACAGTGTGTGCCTTGG - Exonic
927128395 2:20034843-20034865 TGTGGGGACAGTGTTTATTCTGG - Intronic
927649245 2:24901553-24901575 TGTAGGGGGATTCTGTACCCAGG + Intronic
930038677 2:47103943-47103965 TCCTGGGACAGTCTGTAACCAGG + Intronic
933220675 2:79684020-79684042 AGAGGGGGCAGTCTGAACCCAGG + Intronic
937261388 2:120588568-120588590 TCTGGGGACAGTCTGTGCATGGG + Intergenic
938369561 2:130760765-130760787 TGTGGAGACCTTCAGTACCCAGG - Intronic
941618755 2:167753557-167753579 TGTGGGGACAGAATCTCCCCAGG - Intergenic
943080925 2:183258174-183258196 TGTGGGGATAGCCTGTCTCCCGG - Intergenic
944659768 2:201911634-201911656 TGTAGGGGCAGTCTGTTTCCTGG - Intergenic
944895889 2:204164332-204164354 TGTGAGAACAGACTGTACACTGG - Intergenic
946897430 2:224338743-224338765 TGTGGGGACAAACTGTCTCCTGG + Intergenic
947682657 2:232049605-232049627 TGGGGAGACAGTCTGGACACAGG + Intronic
1168790724 20:574152-574174 TGTGGGGAGAGTCAGCAACCAGG - Intergenic
1170575011 20:17655873-17655895 TGTGGGGCCAGTCAGGATCCAGG - Intronic
1170806720 20:19639177-19639199 TGTGTGGACACTCTGTATCTAGG - Intronic
1172094788 20:32455359-32455381 CGTGGGGACATTCTGTACCATGG - Intronic
1172946367 20:38692765-38692787 TGTGGGGACTGGCAGTGCCCAGG - Intergenic
1173343199 20:42173331-42173353 TGTGGGGAGTGTGTGTATCCTGG + Intronic
1177823075 21:26053013-26053035 TGTGGGGACAGGGGGTACACGGG + Intronic
1178562979 21:33656626-33656648 TGGGGGGACCGTTTGAACCCTGG - Intronic
1179629352 21:42666990-42667012 AGTGGGGACAGCCTGGAGCCCGG - Intronic
1179945429 21:44670942-44670964 GGTGGGGAAAGCCTGTACTCAGG - Intronic
1180952095 22:19725047-19725069 TGTGGGGACAGTAAGGACACTGG + Intergenic
1181273162 22:21672710-21672732 TGTGGGGACATTATGCAGCCTGG + Intronic
1181391687 22:22587848-22587870 TGTGAGGACAGGCTGCTCCCAGG - Intergenic
1181536311 22:23547968-23547990 GGTGGGAACATTCTGTTCCCAGG - Intergenic
1183745463 22:39689143-39689165 TGTGGGGAAAGTGGGGACCCAGG + Exonic
1184033186 22:41906532-41906554 GTTGGGGACAGTCTGTACTGTGG - Exonic
1184508540 22:44918522-44918544 GGTGGGGACAGGGTGGACCCGGG - Intronic
1185255631 22:49829168-49829190 CGTGGGGACGGTCTGTCCCAGGG - Intergenic
950615321 3:14153288-14153310 TTTGGGGACTGTCTGTACTGAGG - Intronic
953028947 3:39163772-39163794 TGTGGGCACATCCTATACCCAGG - Intergenic
953342033 3:42142507-42142529 TGTGGGCACAGACTATACTCGGG - Intronic
953622792 3:44547572-44547594 TCTTGGGACAGCCTGTAACCAGG - Intergenic
954871360 3:53769733-53769755 TCTGGGGACATGCTGTGCCCAGG - Intronic
957769474 3:84671449-84671471 TGTGGCCACAGTATGTACCCAGG - Intergenic
961492029 3:127263073-127263095 TGTGGGGACAGCATGCTCCCTGG + Intergenic
962810354 3:138954434-138954456 TGGGAGGACTGTCTGAACCCAGG - Intergenic
964324900 3:155535115-155535137 TGTGGGCACACCCAGTACCCAGG + Intronic
974229542 4:59091918-59091940 GCTGGGGACAGCCTGAACCCTGG + Intergenic
977966133 4:103150488-103150510 TGGGAGGACAGCCTGAACCCAGG + Intronic
979758879 4:124374667-124374689 AGTGGGGATTGTCTGTGCCCAGG + Intergenic
982093071 4:151897072-151897094 TGTGGCCACAGTCTGCATCCGGG + Intergenic
985671273 5:1208225-1208247 TGTGGGGAGAGGCTGTTTCCTGG - Intronic
986281585 5:6327526-6327548 TGAGGAGACAGTCTTTACCCAGG - Intergenic
989964245 5:50450234-50450256 TCTTGGGACAGCCTGTAACCAGG - Intergenic
993733186 5:91446364-91446386 TGTGGGCAAAGTCTATCCCCTGG + Intergenic
997833234 5:137170994-137171016 TATGGGGACAGTCTCTCACCTGG - Intronic
998170243 5:139868525-139868547 TCTGGGGAAGGTCTGTCCCCAGG + Intronic
998192262 5:140036357-140036379 TGAAAGGACATTCTGTACCCAGG - Intronic
998579405 5:143355381-143355403 TGGGAGGACAGTCTGAGCCCAGG + Intronic
1001453807 5:171845860-171845882 GGTGGGGAAAGTCTGCACACAGG - Intergenic
1001622772 5:173102565-173102587 TTTGGGGTCAGTCTGAAACCTGG + Intronic
1001974640 5:175987420-175987442 TCTGGGGAGAGTCTGTAAGCAGG + Intronic
1002261627 5:177997217-177997239 TGTGGGTACAGTGTGTTCCAGGG - Intergenic
1003402705 6:5804087-5804109 TGTGAGGACAATCTGCACGCAGG + Intergenic
1003592613 6:7448437-7448459 TGTGTGGACAGACAGGACCCTGG - Intergenic
1006163338 6:32050335-32050357 TGTGGGGACAGTGAGGACCCTGG + Intronic
1006164589 6:32056923-32056945 TGTGGGGACAGTGAGGTCCCTGG + Intronic
1007693863 6:43719507-43719529 TGTGGGGCCAGCCTGGGCCCTGG + Intergenic
1010758024 6:79690217-79690239 TGTGAGGACTGTCTGTGGCCAGG - Intronic
1011374931 6:86678027-86678049 TGCTGGGACAGCCTGTAACCAGG - Intergenic
1014872574 6:126614535-126614557 TGTGGAGGCAGTCTGTCCCTTGG + Intergenic
1015362544 6:132356073-132356095 TCTGGGGACAGACAGTACCTGGG + Intronic
1024017775 7:45333495-45333517 TGTGGAGGCAGTCTGTCCCTTGG - Intergenic
1024324904 7:48101901-48101923 TGTTGGGATAGTCTCTACCTGGG - Exonic
1027147099 7:75703253-75703275 TGGGAGGACAGCCTGAACCCAGG + Intronic
1030877245 7:114829764-114829786 TGTGGGGGCAGTAAGTACACAGG + Intergenic
1035075194 7:156173224-156173246 TGTGGGGACAGCCTGGCCCTTGG - Intergenic
1035076438 7:156180716-156180738 TTTGGGGACTGTCAGTCCCCAGG - Intergenic
1035396244 7:158536908-158536930 GGTGGAGACAGACTGTGCCCCGG + Intronic
1036643983 8:10600965-10600987 TGTGGGCACACTCTGAGCCCAGG + Intergenic
1041678170 8:60557656-60557678 TGGGAGGATAGTCTGAACCCAGG - Intronic
1041808878 8:61886517-61886539 TGTGGGGATGGCCTGGACCCTGG + Intergenic
1042805088 8:72762539-72762561 TGTGAAGACATTGTGTACCCAGG - Intronic
1042919721 8:73909377-73909399 TCCTGGGACAGTCTGTAACCAGG + Intergenic
1045063310 8:98426433-98426455 TGTGGGCACAGTTTGTGTCCAGG - Intronic
1046790707 8:118318924-118318946 GCTGGGGACAGTTTGTCCCCAGG + Intronic
1049409275 8:142465166-142465188 TGTCTGGAGAGTGTGTACCCTGG + Intronic
1049725304 8:144142949-144142971 GGTGGGGACAGGCTGTGTCCAGG + Intergenic
1051604787 9:18908557-18908579 TGTGGGGAAAAACTCTACCCTGG + Exonic
1056507427 9:87270516-87270538 TGGGGAGACAGTCACTACCCAGG - Intergenic
1056634435 9:88320171-88320193 CCTGGGGACAGCCTCTACCCTGG - Intergenic
1056825421 9:89873427-89873449 TGTGGTGATAGTCCGTCCCCTGG - Intergenic
1058779900 9:108322833-108322855 AATGGAAACAGTCTGTACCCAGG + Intergenic
1059792180 9:117651961-117651983 TGTGAGGACAGTCTGTTACTTGG - Intergenic
1062554993 9:137109851-137109873 TCTGGGGACAGTGGGCACCCTGG + Intergenic
1185630234 X:1511610-1511632 TGGGAGGACAGTTTGAACCCAGG - Intronic
1187489677 X:19739253-19739275 AGCGGGGGCAGTCTGTGCCCAGG + Intronic
1189999022 X:46667206-46667228 TGAGGGGACAATGTGTGCCCAGG + Intronic
1195439679 X:104886114-104886136 TGCTGGGACAGCCTGTAACCAGG + Intronic
1200756441 Y:6994758-6994780 AGTGGGGACATGCTGGACCCGGG + Intronic
1200795707 Y:7339451-7339473 TGTGGGGCCCGTCTGTAGACAGG - Intergenic
1200880703 Y:8209022-8209044 TCCTGGGACAGCCTGTACCCAGG - Intergenic
1202257982 Y:22940672-22940694 TGCTGGGACAGCCTGTAACCAGG + Intergenic
1202410972 Y:24574430-24574452 TGCTGGGACAGCCTGTAACCAGG + Intergenic
1202459809 Y:25095642-25095664 TGCTGGGACAGCCTGTAACCAGG - Intergenic