ID: 1166268207

View in Genome Browser
Species Human (GRCh38)
Location 19:41697654-41697676
Sequence GTGGGGACAGTCTGTACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 143}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166268197_1166268207 7 Left 1166268197 19:41697624-41697646 CCAGCCCCAGACCCTGCAGGTAC 0: 1
1: 0
2: 3
3: 38
4: 393
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268195_1166268207 9 Left 1166268195 19:41697622-41697644 CCCCAGCCCCAGACCCTGCAGGT 0: 1
1: 0
2: 7
3: 95
4: 621
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268199_1166268207 2 Left 1166268199 19:41697629-41697651 CCCAGACCCTGCAGGTACAATAC 0: 1
1: 0
2: 0
3: 15
4: 102
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268203_1166268207 -5 Left 1166268203 19:41697636-41697658 CCTGCAGGTACAATACATGTGGG 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268191_1166268207 28 Left 1166268191 19:41697603-41697625 CCCTGAAACCACAACAAAACCCC 0: 1
1: 0
2: 1
3: 19
4: 340
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268200_1166268207 1 Left 1166268200 19:41697630-41697652 CCAGACCCTGCAGGTACAATACA 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268196_1166268207 8 Left 1166268196 19:41697623-41697645 CCCAGCCCCAGACCCTGCAGGTA 0: 1
1: 0
2: 5
3: 40
4: 350
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268198_1166268207 3 Left 1166268198 19:41697628-41697650 CCCCAGACCCTGCAGGTACAATA 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268193_1166268207 20 Left 1166268193 19:41697611-41697633 CCACAACAAAACCCCAGCCCCAG 0: 1
1: 0
2: 7
3: 67
4: 673
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268201_1166268207 -4 Left 1166268201 19:41697635-41697657 CCCTGCAGGTACAATACATGTGG 0: 1
1: 0
2: 2
3: 8
4: 93
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143
1166268192_1166268207 27 Left 1166268192 19:41697604-41697626 CCTGAAACCACAACAAAACCCCA No data
Right 1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166268207 Original CRISPR GTGGGGACAGTCTGTACCCA GGG Intronic
900216794 1:1486064-1486086 GGGGAGACACTCTGCACCCACGG - Intronic
900830705 1:4963331-4963353 TTGGTGACAGGCTGTTCCCAGGG - Intergenic
906679584 1:47716671-47716693 GTGGGGACACTGGGTAGCCAAGG - Intergenic
912498943 1:110109102-110109124 GTGAGGCCAGTCTTTACCAAAGG - Intergenic
915662336 1:157414768-157414790 CTTGGGAAAGTCTGTGCCCAAGG + Intergenic
918132302 1:181640141-181640163 CTGGGGACTGACTGTCCCCAAGG + Intronic
920701210 1:208219233-208219255 CTGAGGACAGCCTGTAGCCAGGG + Intronic
921746843 1:218749936-218749958 GTGGGTACAGGCTCTCCCCATGG - Intergenic
1063427699 10:5962673-5962695 GTGATGTCAGTGTGTACCCACGG + Intronic
1065660954 10:28003877-28003899 CTGGGGACAGCCTGCACCCAGGG - Intergenic
1068749320 10:60573518-60573540 GTGGGCACAGTGTGTGGCCAGGG - Intronic
1068844673 10:61658706-61658728 GTGGGGACTGTAACTACCCATGG - Intergenic
1069235387 10:66065118-66065140 TTGGGGAAAGTCTTTACCCTGGG + Intronic
1069992472 10:72323869-72323891 CTGGGGACAGCCTGCACCCCCGG + Intergenic
1073056493 10:100706672-100706694 GGGGAGACAGTCTGGACCCAAGG - Intergenic
1075123299 10:119680165-119680187 GTGGGGAAAGTTTCAACCCAAGG - Intergenic
1075179383 10:120196324-120196346 GTGGGAAAAGCCTGTACTCAGGG + Intergenic
1076830549 10:132992285-132992307 GTGGTGTCAGTCGGTCCCCAGGG + Intergenic
1078542191 11:12221654-12221676 ACGGGCACAGCCTGTACCCATGG - Exonic
1079806156 11:24932962-24932984 GTGGGCACATTCAGTCCCCAGGG - Intronic
1080381084 11:31773014-31773036 GTGGTGACCTTCTGTAGCCAGGG - Intronic
1083588086 11:63874894-63874916 GTGGGAAAAGTCTGTTCCCATGG + Intronic
1083775692 11:64893448-64893470 GTGGGGACACCCTGGGCCCAGGG + Intergenic
1083883358 11:65558854-65558876 GTGGGGACAGCCTTTGGCCAGGG + Intronic
1084446853 11:69208831-69208853 GTGGGGACTGTCTGTCCCTCAGG + Intergenic
1085259363 11:75195547-75195569 CTGGAGACAGTCTCTAGCCAGGG - Intronic
1085729410 11:78983656-78983678 GTGGGGACACGCTGCCCCCAGGG + Intronic
1088472021 11:110196829-110196851 TTGGGTACAGTCTGGTCCCAAGG + Intronic
1089365311 11:117917804-117917826 GTGGGGACAGTCTGAATTCTGGG + Intronic
1091208403 11:133835973-133835995 GTGGAGACAGGCTGTGCCAAAGG - Intergenic
1091571403 12:1690114-1690136 TTAGGGAAAGTCTGTGCCCACGG - Intronic
1092533705 12:9366660-9366682 GTGGGGACAGACAGAAGCCAAGG - Intergenic
1095225441 12:39672362-39672384 GTGGGGAAAGCCTGTCCTCAGGG + Intronic
1098633909 12:72757533-72757555 GTGGGGAGAGTTTGTTCTCAGGG - Intergenic
1100774861 12:97962802-97962824 GTAGGAACAGTCTGGACTCAAGG - Intergenic
1101412794 12:104483181-104483203 ATGGGGAGAGACTGTAACCAAGG - Intronic
1103547602 12:121713046-121713068 GTGGGGACAGTCAGGGCCTAGGG + Intronic
1104717304 12:131024604-131024626 GTGGGCACAGTTTGTAGCCTAGG + Intronic
1112947129 13:104942952-104942974 TTGGGGACAGTCTCTAGCCAAGG - Intergenic
1115364600 14:32543771-32543793 TTGGGGACAGCCTCTATCCAGGG + Intronic
1115537476 14:34386706-34386728 GTGTGAACAGTGAGTACCCATGG - Intronic
1118318366 14:64738957-64738979 GTGGGGAATCTCTGTTCCCATGG - Intronic
1118885294 14:69860691-69860713 GTGGGTCCAGTCTGTTCCCCAGG - Intronic
1119423714 14:74522985-74523007 GTGGGGACAGTCAGTGGCCAGGG + Intronic
1120820870 14:88910649-88910671 GTGGGGACAGGCTGTGGCCCAGG - Intergenic
1121114174 14:91331883-91331905 CTGGGCACAGTGTATACCCAGGG - Intronic
1121114197 14:91331988-91332010 CTGGGCAGAGTCTGCACCCAGGG - Intronic
1123019483 14:105390998-105391020 GTGGGGACAGACAGTGCTCAGGG - Intronic
1127231302 15:56998647-56998669 GTTCGGACATTCTGTACCCCCGG - Intronic
1129936433 15:79454065-79454087 GTGGGGACAGCCTGTCACAAGGG - Intronic
1130398751 15:83529655-83529677 GTGGGGAGAGCTTGTCCCCAAGG + Intronic
1131173157 15:90192393-90192415 CTGGGCAGAGGCTGTACCCATGG + Intronic
1132294819 15:100727268-100727290 GTGGGGACACTGAGTCCCCACGG + Intergenic
1132466587 16:80194-80216 GTGGGGACAGGCTGCACCGTAGG - Intronic
1133111426 16:3550278-3550300 CTGAGGACAGTGTGTGCCCAGGG + Intronic
1133119324 16:3596513-3596535 GTGGGGACAGACTGTCCCCGGGG + Intronic
1136107232 16:28038579-28038601 GTGGGGGGAGTCTGTCTCCATGG + Intronic
1137815372 16:51393117-51393139 GTGGGGACAGCCTCTTCTCAAGG - Intergenic
1138637118 16:58349134-58349156 GTGAGGACAGTTTGCCCCCAGGG - Intronic
1140557333 16:75936772-75936794 ATGGGGACAGACTTTCCCCACGG + Intergenic
1140687561 16:77448286-77448308 CTGGGGACATTCTCCACCCAGGG + Intergenic
1141403814 16:83774016-83774038 ATGGGGACAGTCTGTGCTGATGG - Intronic
1143230219 17:5347680-5347702 GTGGGGAAAGAATGTACCCCTGG - Intronic
1144481171 17:15630183-15630205 GAGGGAACAGGCTGTACCAAAGG - Intronic
1144917139 17:18733548-18733570 GAGGGAACAGGCTGTACCAAAGG + Intronic
1150128570 17:62653927-62653949 GTGGACACAGTCTCTAGCCAGGG + Intronic
1152000650 17:77643242-77643264 GAGGGAACAGTGGGTACCCAGGG - Intergenic
1158920468 18:62186709-62186731 GTGGTGACATTTTGTCCCCATGG - Intronic
1159898374 18:74019084-74019106 GAGGTCACAGTCTCTACCCATGG + Intergenic
1160168019 18:76530701-76530723 CTGGGGACAGGCTGTGTCCAGGG + Intergenic
1160899875 19:1422268-1422290 GTGGGAACAGGCTGTGCCCTCGG + Intronic
1161218650 19:3107650-3107672 CTGGGGGCAGTCTTGACCCATGG + Intronic
1161444518 19:4310821-4310843 CTGGGAAAACTCTGTACCCAGGG + Intronic
1161515741 19:4695318-4695340 GTGGGGACAGTGTGACTCCAGGG + Intronic
1162061272 19:8096896-8096918 CTGGCGACAGTTTGTACCCTCGG + Exonic
1163111961 19:15166776-15166798 GGGAGGTCAGTCTCTACCCAGGG - Intronic
1165100908 19:33438260-33438282 GTGGGCACAGCCTGTACCCTGGG - Intronic
1166220511 19:41361343-41361365 GAGGGGACAGCCTCTGCCCAGGG + Intronic
1166268207 19:41697654-41697676 GTGGGGACAGTCTGTACCCAGGG + Intronic
1166632558 19:44419961-44419983 GTTGGGACAGGCTGAAGCCATGG + Intronic
1166725104 19:45022143-45022165 GTGGGGAAAGACTGCACCGACGG + Exonic
1167949445 19:53014691-53014713 GTGGGGACAGTGTGTGCCTTGGG - Exonic
1167954013 19:53049852-53049874 GTGGGGACAGTGTGTGCCTTGGG - Exonic
1168270479 19:55247198-55247220 TTGGGGAGAGGCTGTGCCCAAGG - Intronic
926197999 2:10775194-10775216 ATGGGGACCGTCTGTTCTCATGG + Intronic
929196647 2:39191754-39191776 GTGTGGACTGCCTGGACCCAAGG + Intronic
930774441 2:55158631-55158653 GTAGGGCCAGTTTGTAGCCAAGG - Intergenic
932975399 2:76594141-76594163 GAGGGGATATTCTGTACCCAAGG + Intergenic
933220676 2:79684021-79684043 GAGGGGGCAGTCTGAACCCAGGG + Intronic
936521771 2:113216056-113216078 CTGGGGACACTCTGTACCCCCGG - Exonic
938316486 2:130332737-130332759 GTGGGGCCAGTCTGTAAGCAAGG + Intergenic
940185994 2:150985521-150985543 GTGAGGACAGTAGGTGCCCAAGG - Intergenic
943782801 2:191843693-191843715 GTGAGGTCAGTTTTTACCCAAGG + Intronic
946325767 2:218984140-218984162 GTGGGAGCAGTGTGGACCCAGGG - Intronic
947682658 2:232049606-232049628 GGGGAGACAGTCTGGACACAGGG + Intronic
947967507 2:234293989-234294011 GTGGGGAAAGACTGTACAGAGGG - Intergenic
948988491 2:241540262-241540284 GTGGGCTCAGTCTGGACCCCTGG + Intergenic
1171166386 20:22975541-22975563 GTGGGGATGGCCTGTGCCCAGGG - Intergenic
1172094787 20:32455358-32455380 GTGGGGACATTCTGTACCATGGG - Intronic
1174047622 20:47744732-47744754 CTGGGGCCAGTCTGCTCCCAGGG + Intronic
1174172042 20:48623820-48623842 GAGGGGACAGTGTGGATCCAAGG - Intergenic
1175261899 20:57679969-57679991 GCGTGGACAGCCTGTACCCAAGG - Intronic
1175400332 20:58696523-58696545 GTGGGGGCAGTCAGTCCCCATGG + Intronic
1176130361 20:63494266-63494288 GTGCGAACAGTCTGTAGCCCAGG - Intronic
1177342380 21:19820846-19820868 GGGAGGACAGTCTCTACACATGG + Intergenic
1179629351 21:42666989-42667011 GTGGGGACAGCCTGGAGCCCGGG - Intronic
1179945428 21:44670941-44670963 GTGGGGAAAGCCTGTACTCAGGG - Intronic
1181005801 22:20012888-20012910 CTGGGCCCAGTGTGTACCCATGG - Intronic
1181536310 22:23547967-23547989 GTGGGAACATTCTGTTCCCAGGG - Intergenic
1182856676 22:33523421-33523443 GTGTTGATACTCTGTACCCATGG + Intronic
1184508539 22:44918521-44918543 GTGGGGACAGGGTGGACCCGGGG - Intronic
1185049890 22:48548530-48548552 GTGGGGTCAGACTGGACCCCAGG + Intronic
949562471 3:5215078-5215100 GTGGGGGCAGTCGGGACCAATGG + Intronic
952537199 3:34323348-34323370 GTGAGGACAGTCTGTTCTGAAGG + Intergenic
953033138 3:39190891-39190913 GTGGGGACCCTCAGTACCCTTGG + Intronic
953262448 3:41352954-41352976 GTCAGAACAGTCAGTACCCATGG + Intronic
957930367 3:86870801-86870823 CAGGGGACAATTTGTACCCATGG + Intergenic
959573068 3:107906477-107906499 GTGGGGACAGACTGTTCCAAAGG - Intergenic
960672423 3:120166311-120166333 GTGGGGACAGTCAGGACCTCAGG + Exonic
961823974 3:129589266-129589288 AGGGGGTCAGTCTGTACACAGGG - Intronic
962404407 3:135088190-135088212 GTGGGGACATTCTGTAACGATGG - Intronic
964324901 3:155535116-155535138 GTGGGCACACCCAGTACCCAGGG + Intronic
966649271 3:182281244-182281266 GTGGGGCCAGTGTGTATTCATGG + Intergenic
969568316 4:7993072-7993094 GTGGTGACCTTCTGTTCCCAGGG + Intronic
970511358 4:16784894-16784916 GTGTCGACAGTCTACACCCAGGG - Intronic
971153214 4:24055855-24055877 GCTGGGACATTCTGTTCCCAAGG + Intergenic
974229543 4:59091919-59091941 CTGGGGACAGCCTGAACCCTGGG + Intergenic
977966134 4:103150489-103150511 GGGAGGACAGCCTGAACCCAGGG + Intronic
979049648 4:115913670-115913692 GTGGGGACACTAACTACCCAAGG - Intergenic
980321939 4:131290721-131290743 GGGGGGGCAGTCTGTAGCCAAGG + Intergenic
981691354 4:147513100-147513122 TTGGGGTCAGTCTGCCCCCAAGG + Intronic
981903463 4:149892961-149892983 GTGGGGACATTCTGTAGACACGG - Intergenic
984629433 4:182045269-182045291 CTGAGGAGGGTCTGTACCCAAGG + Intergenic
985529456 5:425140-425162 ATGGGGACCGTCTGCACCCAAGG - Intronic
985950429 5:3218321-3218343 GTGGGGCCAGGCTGGAGCCAGGG + Intergenic
986281584 5:6327525-6327547 GAGGAGACAGTCTTTACCCAGGG - Intergenic
988487438 5:31678471-31678493 CTGGGGACAGTCAGTTCTCAGGG + Intronic
998129781 5:139645878-139645900 GTGGGGACAGTCTCACCCAAGGG + Intergenic
998170244 5:139868526-139868548 CTGGGGAAGGTCTGTCCCCAGGG + Intronic
1006163339 6:32050336-32050358 GTGGGGACAGTGAGGACCCTGGG + Intronic
1011227016 6:85118733-85118755 GTGGAAACAGCCTGAACCCATGG - Intergenic
1014171925 6:118288311-118288333 GTGGTGACAATATGTGCCCAAGG + Intronic
1018961123 6:168449276-168449298 GTGAGGAAAGTTTGTACACATGG - Intronic
1024087925 7:45912070-45912092 GTTGGGACAGTCTGTGGCCCAGG - Intergenic
1025964467 7:66255178-66255200 GTGGGGACAGTTTGTTCCCTAGG + Intronic
1030917782 7:115338493-115338515 GTGGGGACAGTGTGTAAGCACGG - Intergenic
1034469330 7:151247246-151247268 GTGGGGAGAGGCTGTACACGTGG - Intronic
1034719342 7:153274812-153274834 GTGGGGATAGTGTGTACTGAAGG + Intergenic
1036765241 8:11545888-11545910 TCAGGGACATTCTGTACCCAGGG - Intronic
1048988297 8:139747294-139747316 GTGGGCACGGTCAGCACCCAGGG + Intronic
1049297836 8:141852570-141852592 GCGAGGACAGCCTGGACCCAGGG + Intergenic
1050191656 9:3032925-3032947 GTGCGGTCAGGCTGTAGCCATGG - Intergenic
1053224836 9:36345560-36345582 CTGGGGACAGTTTGTCCCCTAGG - Intronic
1056321591 9:85440344-85440366 GTGGAGCCAGCCTGTCCCCAAGG - Intergenic
1056341333 9:85635682-85635704 GATGGGAAAATCTGTACCCAAGG - Intronic
1056507426 9:87270515-87270537 GGGGAGACAGTCACTACCCAGGG - Intergenic
1059599951 9:115766360-115766382 GTAGGGAATGTCTGAACCCATGG - Intergenic
1061499424 9:130993539-130993561 GGGGGGACAGCCTGGACCCCTGG + Intergenic
1062662007 9:137641762-137641784 GGGAGGAGAGTCTGGACCCAAGG + Intronic
1186350314 X:8732596-8732618 GTGGGAAAAGCCTGGACCCAGGG - Intergenic
1186695410 X:12025520-12025542 GTGAGTCCAGTCTGTACACAAGG - Intergenic
1187013829 X:15306914-15306936 GGTAGGACAGTCTTTACCCATGG + Intronic
1190302702 X:49065705-49065727 GTGGGTACAGTCTCTAACCTAGG + Intronic
1192042847 X:67641474-67641496 GGGGGCACAGTTTTTACCCAAGG + Intronic
1192656752 X:73001820-73001842 GAGGGATCAGTCTGTGCCCAAGG - Intergenic
1192665368 X:73081181-73081203 GAGGGATCAGTCTGTGCCCAAGG + Intergenic
1199679537 X:150215494-150215516 CCGGGGACAGTGTGCACCCATGG + Intergenic
1199695694 X:150341555-150341577 CCGGGGACAGTGTGCACCCATGG - Intergenic