ID: 1166268973

View in Genome Browser
Species Human (GRCh38)
Location 19:41701890-41701912
Sequence CTCCTGTTAATGAGCAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166268970_1166268973 -9 Left 1166268970 19:41701876-41701898 CCTCTAGTGGGCGCCTCCTGTTA 0: 1
1: 0
2: 1
3: 0
4: 28
Right 1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG 0: 1
1: 0
2: 3
3: 16
4: 184
1166268967_1166268973 10 Left 1166268967 19:41701857-41701879 CCAGGAAGGGCGATGGCGTCCTC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG 0: 1
1: 0
2: 3
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166268973 Original CRISPR CTCCTGTTAATGAGCAAAAA GGG Intronic
901110562 1:6790258-6790280 CTCCTGCTGAGGAGGAAAAAAGG - Intronic
902760083 1:18575380-18575402 CTCCTTTTCATGAGCAGAAAGGG - Intergenic
903597827 1:24509510-24509532 TTCCTGTGAATGAGCAAAGAGGG - Intronic
904058521 1:27687976-27687998 CTCCAGTTAATCCACAAAAAGGG + Intergenic
905134350 1:35787018-35787040 CTCCTGTGAAGGAGGAACAACGG + Intergenic
905255647 1:36681172-36681194 CTCCTGTTAATGAGCACTTTTGG + Intergenic
905304741 1:37009810-37009832 ATCGTGGTAATGAGGAAAAATGG + Intronic
908777355 1:67653388-67653410 CTCTTGTTACTGTGCAGAAAGGG + Intergenic
908954249 1:69601765-69601787 TCCTTGTTAATAAGCAAAAAAGG - Intronic
909957391 1:81796310-81796332 GTACTGTTAATGAGAAAACAAGG + Intronic
911460656 1:98185565-98185587 CTCCAGTTGATGAGCACTAATGG + Intergenic
912541435 1:110419176-110419198 CTCCTGTTGATGAGGGGAAATGG - Intergenic
912827710 1:112921460-112921482 CACCTTTTTTTGAGCAAAAAAGG - Intronic
913659165 1:120991477-120991499 TTCCTGTTAATAAGCCAAACGGG - Intergenic
913970031 1:143407837-143407859 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
914010529 1:143774602-143774624 TTCCTGTTAATAAGCCAAACGGG - Intergenic
914064405 1:144233434-144233456 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
914114745 1:144732920-144732942 TTGTTGGTAATGAGCAAAAAAGG + Intergenic
914167294 1:145186511-145186533 TTCCTGTTAATAAGCCAAACGGG + Intergenic
914649150 1:149683261-149683283 TTCCTGTTAATAAGCCAAACGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917941758 1:179929010-179929032 CACTTCTTAAGGAGCAAAAATGG + Intergenic
918106030 1:181415886-181415908 CTAATGTTACTGAGCAAAGAGGG + Intronic
918534532 1:185559692-185559714 CTCCTTTAAAGGAGCAACAAAGG - Intergenic
918649825 1:186948297-186948319 ACCCAGTTAATGAGCAAACAAGG + Intronic
918657928 1:187052294-187052316 CTTGTGTTAAGGAGTAAAAAAGG - Intergenic
922968591 1:229715200-229715222 CTCATGCTAATGAGCAATGAGGG - Intergenic
923202439 1:231725379-231725401 CTTATGCTAATGAGCAATAAGGG - Intronic
1064798288 10:19039086-19039108 CTGCTGTTGATGAGCACACAGGG - Intergenic
1068041244 10:51826775-51826797 CACCTGTTAATCATCAAGAAAGG + Intronic
1069116390 10:64511674-64511696 CTCCTTTTAAAGAGCACACATGG - Intergenic
1073353847 10:102838081-102838103 GTCCTGCTGATGAGCAAAGAAGG - Intergenic
1073665553 10:105529314-105529336 CTCCTATTAAAGAGAAAAAATGG + Intergenic
1075371966 10:121944961-121944983 CTCCTGTTGGTGAGCCAAGATGG - Intergenic
1076116183 10:127903008-127903030 CTACTGATAATAAGCAATAAAGG + Intergenic
1080040311 11:27753319-27753341 TTCCTCTTAAGGAGCCAAAAAGG + Intergenic
1081901896 11:46635763-46635785 CTACAGTTATTGAGCCAAAAAGG - Intronic
1082062001 11:47868812-47868834 CTCCTGGTAATCAACACAAAGGG - Intergenic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1085725675 11:78952609-78952631 ATCCTGAGAAGGAGCAAAAATGG - Intronic
1086740301 11:90359708-90359730 CTCCTGATAATAAGCAAAGAAGG - Intergenic
1089326084 11:117658175-117658197 CTCCTGTTTATGCTTAAAAATGG - Intronic
1090833341 11:130435679-130435701 CTCCTGTTCATGAGAACAGAAGG - Intergenic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1093193219 12:16099378-16099400 ATCTAGTTAATGGGCAAAAATGG + Intergenic
1094277975 12:28700289-28700311 CTCCTGCTACTGGGCAAGAAGGG + Intergenic
1095195805 12:39315241-39315263 CTGCTGATGATCAGCAAAAATGG + Intronic
1095276486 12:40290124-40290146 CACCTATTAATGATAAAAAAAGG - Intronic
1096245239 12:49981219-49981241 CTGCAGTTAATTAGCAGAAAAGG + Intronic
1096376205 12:51113033-51113055 CTCCTATTAATGATCAAACTGGG + Intronic
1100194245 12:92226037-92226059 CTCCTGTTAATCACCAGATATGG - Intergenic
1101299904 12:103468597-103468619 CTCCTGTTAAACACCAAGAATGG - Intronic
1101530476 12:105568878-105568900 CTTATGTTAATGAGCAATGAGGG + Intergenic
1102956159 12:117060451-117060473 CTCCCACTAATGAGGAAAAAGGG - Intronic
1104236311 12:126941170-126941192 CTCCTGGAAATGAGAAAAACAGG - Intergenic
1104239574 12:126974917-126974939 CTCATGTTGAGGAGCATAAACGG + Intergenic
1106386629 13:29291689-29291711 CTCCTGATAATGAAAAAAGAAGG - Intronic
1108102082 13:46967395-46967417 TGTTTGTTAATGAGCAAAAAAGG + Intergenic
1110927424 13:81172484-81172506 CTCCTGTGTAAGAGCAAATACGG + Intergenic
1111179614 13:84645896-84645918 CTTCTGCTAATGAGCAATGAGGG + Intergenic
1111720233 13:91934638-91934660 TTCATGTTTATGAGCCAAAAAGG - Intronic
1112435565 13:99389310-99389332 CTGCAGTTAATGAACAAAAGAGG - Intergenic
1112999901 13:105622490-105622512 ATCCTATTAATGAGCATAAATGG - Intergenic
1113748761 13:112764468-112764490 CTCCTGATGATGAGCAGAACAGG + Intronic
1114850661 14:26379020-26379042 CTCATGCTAATGAGCAATGAGGG + Intergenic
1115165451 14:30443703-30443725 CTCTTGTTACTTAGCAAAGAAGG - Intergenic
1115197620 14:30818482-30818504 CTCCTATTAATGAGAGACAATGG + Intergenic
1115744298 14:36420136-36420158 CTTCTGTTTATAAGAAAAAATGG - Intergenic
1120099605 14:80429190-80429212 CCCATGTTAATGAGGAAAAAAGG - Intergenic
1120533789 14:85667229-85667251 CTACTTTTAATGACAAAAAATGG - Intergenic
1121953181 14:98190120-98190142 CTCCTGTTACTGAGTCAAAGGGG - Intergenic
1122301387 14:100733131-100733153 TTCCTGCTAATAAGCAGAAATGG - Intronic
1122368875 14:101216417-101216439 TTCCTGTTTATTAACAAAAAAGG - Intergenic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1127013281 15:54653883-54653905 TTCCTGTTAATGGGAAAGAAGGG - Intergenic
1127601327 15:60540197-60540219 TTCCTGTTAAGGAGAAAAAAAGG - Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1128270693 15:66306745-66306767 CTCTTGCTAAGGATCAAAAAAGG - Intronic
1128947481 15:71838679-71838701 ATCCTGTTAATGTGCTATAAAGG - Intronic
1134836779 16:17368004-17368026 CTCTTGTGAAGGAGCAAAAGAGG - Intronic
1136681293 16:31964736-31964758 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1136781605 16:32906248-32906270 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1136888188 16:33947592-33947614 CTGCTGGAAATGAGCAACAAGGG - Intergenic
1138695286 16:58807312-58807334 CTCCTATTAATTACCTAAAAAGG - Intergenic
1139030969 16:62879733-62879755 GTCCTGTTAATAAGGAAAAAAGG - Intergenic
1139280722 16:65768107-65768129 CTGCTTTTAATGAGCAATCAGGG - Intergenic
1141013780 16:80428280-80428302 CACCTGTTATTGAGCATTAAAGG - Intergenic
1203084260 16_KI270728v1_random:1170230-1170252 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1143563432 17:7708286-7708308 CTCCTGATACTGAGCAGAGAGGG + Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1144153385 17:12473144-12473166 CTCCAGTTAATGAGCAAATCTGG - Intergenic
1148402502 17:47378631-47378653 ATCCTGATAAGCAGCAAAAAGGG - Intronic
1149345201 17:55727527-55727549 CTCCTGTAAACGAGCACCAAAGG - Intronic
1153471006 18:5445385-5445407 CTCCTGTTTAAGTGCAAAAATGG + Intronic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1159773217 18:72573568-72573590 TTCCTGTTACTGAGTAAAAGAGG - Intronic
1162867272 19:13557723-13557745 CTCCTGGAAATGAACAGAAAAGG + Intronic
1164196140 19:22961852-22961874 GTCCTCTTAATCAGAAAAAAAGG - Intergenic
1164445116 19:28310530-28310552 CTCCTTATAATGAACACAAATGG + Intergenic
1164504105 19:28843961-28843983 ATTCTGTAAATGAGCAAACAGGG - Intergenic
1164771356 19:30811837-30811859 CCCCTGCTAATGTGCATAAATGG + Intergenic
1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG + Intronic
1166420883 19:42635081-42635103 CTCCTGCTAAGGAGCAAAAAGGG - Intronic
1166616903 19:44257526-44257548 CTCCAGTTAAAAGGCAAAAATGG + Intronic
1168453781 19:56488159-56488181 CTCTTGCAAATGAGAAAAAAGGG - Intergenic
926352728 2:12011539-12011561 CTCCTGATAGTCAGCAAAAGTGG + Intergenic
929056763 2:37885002-37885024 CTCTTCTTAGTGAGAAAAAATGG - Intergenic
929462998 2:42118318-42118340 CTCCTGCTTCTGAGCAAAACTGG + Intergenic
930423812 2:51187950-51187972 ATTCTTTTAATGAGGAAAAAAGG + Intergenic
930739171 2:54811708-54811730 CTCAGCTTAATGAGCAAACATGG + Intronic
930865445 2:56118242-56118264 TTCCTGTTAATGAGGAAAATTGG + Intergenic
931009610 2:57894563-57894585 ATAGTGTTAATGAGCAATAAAGG - Intergenic
931169332 2:59786263-59786285 CTACTACTAATGAACAAAAAAGG + Intergenic
932604039 2:73152133-73152155 TTCCTTTTAGTGAGCAAAATTGG - Intronic
934174720 2:89568742-89568764 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
934285037 2:91643094-91643116 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
934872686 2:97881568-97881590 CTCCTGTTACAGAGTAAAACTGG + Intronic
939501690 2:142994387-142994409 CTCCTCTTGAAGAGCAAAACAGG - Intronic
940877897 2:158916436-158916458 TTGCTATTAATGAGCAAAGAAGG - Intergenic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
945115440 2:206403785-206403807 CCCCTGTTATTGAACATAAAAGG - Intergenic
1169789747 20:9397219-9397241 TTCTTGTGAATGAGCAAAGAAGG - Intronic
1172586207 20:36086855-36086877 CTCCTTTCAATGTTCAAAAATGG - Intergenic
1173308084 20:41871055-41871077 CTTATGTTAATGAGCAATGAGGG - Intergenic
1174830643 20:53809082-53809104 CTCCATTCATTGAGCAAAAAAGG - Intergenic
949793175 3:7816021-7816043 CATCTGTTAATGAGGACAAAAGG - Intergenic
952854201 3:37754350-37754372 CTCTTGTTAATATGCAAGAAGGG + Intronic
955869319 3:63419783-63419805 CTCATGTGAAGGATCAAAAAGGG + Intronic
956029340 3:65020341-65020363 TTCCTGGTAATGAACAAAACAGG + Intergenic
958692421 3:97484794-97484816 CTCCTGTAAATGACCAAAGCTGG + Intronic
965520417 3:169664061-169664083 CTCCTGTTAAAGAACTAGAAGGG + Intergenic
969828565 4:9777632-9777654 TTGTTGGTAATGAGCAAAAAGGG - Intronic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
971977245 4:33706609-33706631 ATCCAGTTAATGAAGAAAAAAGG - Intergenic
974160165 4:58128617-58128639 TTCCAGTTAATGAGCAAAAGGGG - Intergenic
976495857 4:85728575-85728597 CTTCTGTAAATGTGCAAAATAGG - Intronic
976991110 4:91367561-91367583 CTACTGGTAAAGAGCAAAGAGGG - Intronic
977094485 4:92722431-92722453 CTCCTGAGAATGAGGAAAAGGGG + Intronic
978263910 4:106799073-106799095 CTCCTTTTAAAGAGTAATAAAGG + Intergenic
978471913 4:109077451-109077473 CTCCTGCTAAGGAACAAAAGCGG + Intronic
979781191 4:124652980-124653002 CTACTTCTAATGAGCAGAAAAGG - Intergenic
980805745 4:137811251-137811273 CTCCTGTAAATGTGAAAAACAGG + Intergenic
982930093 4:161393816-161393838 CTCCTATAAATGAGCAGACAAGG + Intronic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983391436 4:167135875-167135897 GATCTGTTAATGAGCTAAAAAGG + Intronic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
986442064 5:7791668-7791690 CTCCTGTTAACGAGAACAGAGGG - Intronic
989437651 5:41433583-41433605 CTCCTGTGCCTGAGCAAACATGG - Intronic
993101834 5:83550262-83550284 CTCCTGTTCATGAACATAGAAGG - Intronic
994386367 5:99137542-99137564 TTCCTTCAAATGAGCAAAAAAGG - Intergenic
995655051 5:114416992-114417014 CTCCTGTTTTTGAACAAAACTGG + Intronic
999033100 5:148316485-148316507 ATTCTGTTAATTGGCAAAAAGGG - Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000188471 5:158884806-158884828 TTCCTGTCAATAAGCACAAATGG - Intronic
1000473702 5:161678461-161678483 GTACTGTTAAGGAGAAAAAAAGG - Intronic
1003374693 6:5565023-5565045 GTCCTGTTGATGAAGAAAAATGG + Intronic
1003935687 6:10973000-10973022 CTTCTGTTAATAAGGAAACAGGG + Intronic
1004090405 6:12494687-12494709 CTCATGTGAATGAGCACAAAGGG + Intergenic
1005266140 6:24114043-24114065 CTACTGTTAAGGGGGAAAAAAGG + Intergenic
1005640537 6:27792119-27792141 CTCCTGTGTATGTGCGAAAAAGG - Intergenic
1008826896 6:55706442-55706464 CTCTTGATAATGAGTAAAATTGG + Intergenic
1009820372 6:68792409-68792431 CTACTGTTATTTAGCAATAATGG - Intronic
1010260892 6:73815701-73815723 ATCTTGTTAATAAGGAAAAAGGG + Intronic
1010346481 6:74816109-74816131 CTCCTGTGCATGAGCTAAAGTGG + Intergenic
1010355448 6:74927373-74927395 ATCCCTTTATTGAGCAAAAATGG + Intergenic
1010791702 6:80072493-80072515 CTCCTAATAAAGAGTAAAAAGGG + Intergenic
1011136170 6:84103461-84103483 TTCCTGATAATGAGCAAAATAGG + Intergenic
1014015747 6:116528040-116528062 GTCCTGATTATGAACAAAAATGG + Intronic
1015716735 6:136200525-136200547 CTCCTGTTAAAAAAAAAAAAAGG - Intergenic
1016017517 6:139201061-139201083 CTCCTGTGAATGAGGAAGAGGGG - Intergenic
1017531709 6:155299263-155299285 CTTCTCTTTGTGAGCAAAAAGGG + Intronic
1020047972 7:5057664-5057686 ATCCTGTTAATGGGAAAAGAAGG - Exonic
1027516030 7:79142902-79142924 CACTTGTCAAAGAGCAAAAAGGG - Intronic
1030914718 7:115298150-115298172 CTCCTGGTAATGATCAAATTTGG - Intergenic
1031281657 7:119810268-119810290 TTCTTATGAATGAGCAAAAAAGG - Intergenic
1031733549 7:125328403-125328425 CTCCTTTTAATGAGCCAAAATGG - Intergenic
1031940464 7:127783350-127783372 ATCCTGTCAATCACCAAAAAGGG - Intronic
1036280337 8:7394822-7394844 TTCTTGTTAATGTGCATAAATGG - Intergenic
1036341189 8:7917064-7917086 TTCTTGTTAATGTGCATAAATGG + Intergenic
1039331878 8:36546732-36546754 CTCCTGAGAATGCGCAATAAGGG - Intergenic
1039662544 8:39482884-39482906 CTCTTGCTCATGAACAAAAAGGG - Intergenic
1039935096 8:42036155-42036177 CTACTGAAAATGAGAAAAAAAGG + Intronic
1040446296 8:47498271-47498293 ATTCTGGTAATGAGCAACAAAGG + Intronic
1040979770 8:53234393-53234415 CCCTTGTTAAAGAGAAAAAAAGG + Intronic
1043952886 8:86328943-86328965 AACCTGTCAATGAACAAAAAGGG + Intergenic
1044217378 8:89628226-89628248 CTCCTGCTAATGGGCAATGATGG - Intergenic
1046713217 8:117537260-117537282 CGCCTGTTAATGTACAAAATTGG + Intronic
1050084422 9:1949834-1949856 TTCCTGGAAATGAGAAAAAAGGG - Intergenic
1052188013 9:25622099-25622121 CTCCTCTGAAGGAGAAAAAAAGG + Intergenic
1052648066 9:31263638-31263660 ATTCTGTTAATAGGCAAAAATGG + Intergenic
1052721184 9:32172922-32172944 GTATTGTTAATGAGCAAAAATGG - Intergenic
1059174256 9:112154919-112154941 CTCCTCTTAATGGGCAGAAAGGG - Intronic
1060705704 9:125798146-125798168 CATCTGTCAATGAGCTAAAAAGG + Intronic
1187264202 X:17716450-17716472 CTCATGTTAAGTAGGAAAAAAGG - Intronic
1187400991 X:18960083-18960105 CTCCTGTTGATGAAAAATAAAGG + Intronic
1188914567 X:35894292-35894314 CTTCTGTTAATACACAAAAATGG - Intergenic
1190953297 X:55167309-55167331 CTCATGCTAATAAGCAATAAGGG - Intronic
1196115207 X:111991830-111991852 CTCCTGTGTATTAGGAAAAATGG - Intronic
1197756475 X:129998842-129998864 CTACTGTTAATTAGCAACAGTGG + Intronic
1197840959 X:130746194-130746216 TTCCCGTTAATGAGCAGCAATGG + Intronic
1198074160 X:133178990-133179012 CTTCAGGAAATGAGCAAAAAAGG + Intergenic
1199557957 X:149129577-149129599 CTCTTGATAATAAGAAAAAACGG + Intergenic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic
1199963193 X:152796106-152796128 CACCTTGCAATGAGCAAAAAAGG - Intergenic