ID: 1166269339

View in Genome Browser
Species Human (GRCh38)
Location 19:41704348-41704370
Sequence GACACTGGTGTTCCCACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166269339_1166269347 26 Left 1166269339 19:41704348-41704370 CCAGGAGTGGGAACACCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1166269347 19:41704397-41704419 CTCTCCCATATGCCCATACCAGG 0: 1
1: 0
2: 1
3: 9
4: 112
1166269339_1166269341 -2 Left 1166269339 19:41704348-41704370 CCAGGAGTGGGAACACCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1166269341 19:41704369-41704391 TCTAAGCCCCTGATGAGAACAGG 0: 1
1: 0
2: 0
3: 7
4: 113
1166269339_1166269342 -1 Left 1166269339 19:41704348-41704370 CCAGGAGTGGGAACACCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1166269342 19:41704370-41704392 CTAAGCCCCTGATGAGAACAGGG 0: 1
1: 0
2: 0
3: 16
4: 133
1166269339_1166269343 2 Left 1166269339 19:41704348-41704370 CCAGGAGTGGGAACACCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1166269343 19:41704373-41704395 AGCCCCTGATGAGAACAGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166269339 Original CRISPR GACACTGGTGTTCCCACTCC TGG (reversed) Intronic
900955339 1:5883247-5883269 AGCACTGATGTTCACACTCCGGG + Intronic
901400746 1:9013787-9013809 CACCCTGGTGTCCCGACTCCAGG - Intronic
902726125 1:18337430-18337452 GTCTCTGATGTGCCCACTCCTGG + Intronic
903965832 1:27088835-27088857 CAGACTGGTAATCCCACTCCAGG - Intergenic
904316099 1:29664760-29664782 GACACCAGTGTTCCTACTACAGG + Intergenic
904573732 1:31488122-31488144 GAGACTGGTGTTCTCAAGCCCGG - Intergenic
908385960 1:63642094-63642116 GACCCTGGGGTTCCCAACCCTGG - Intronic
915069553 1:153254902-153254924 GCTACTGGTGTTCCCTCTCCAGG - Intergenic
919188879 1:194189760-194189782 GAGACTGGTGTTCTCAAACCTGG + Intergenic
920564276 1:206961067-206961089 GACACAGTTGCTTCCACTCCAGG - Exonic
920869923 1:209785434-209785456 TACACTGGAGTTGTCACTCCTGG + Intergenic
921181778 1:212637147-212637169 GACACTGGAGCCCACACTCCTGG + Intergenic
923704972 1:236336623-236336645 GTCAAGGGTGTTCCCTCTCCAGG + Intergenic
924498352 1:244612075-244612097 GACTCTGGAGTGCCCACGCCAGG + Intronic
1069934972 10:71909106-71909128 GACAAAGGTGTTCCCAGTACAGG + Intergenic
1070817948 10:79336910-79336932 GACACAGATCTTCCCAGTCCTGG - Intergenic
1071564098 10:86662681-86662703 AACACAGGTCTTCCAACTCCAGG + Intronic
1072073467 10:91944201-91944223 GAAACTGCAGTTCCCAATCCTGG - Intronic
1074852750 10:117451838-117451860 AACACTGCTGTCCCCATTCCTGG - Intergenic
1080769341 11:35325996-35326018 CACACTGGTTTTCCCAATGCAGG - Intronic
1083764890 11:64836961-64836983 GACACTGGAGCTTCCGCTCCAGG + Exonic
1083797451 11:65025459-65025481 GAGACTGGTGTTCCCAAACCTGG - Intronic
1085371390 11:76009752-76009774 AACACAGGTTTTCCAACTCCTGG - Intronic
1085394234 11:76198720-76198742 GACCCAGCTGTTCTCACTCCTGG + Intronic
1091836051 12:3586558-3586580 GATACTGGTGTTACCCGTCCAGG - Intronic
1092380809 12:7995495-7995517 GACACTGTTCTGCCCACGCCTGG - Intergenic
1092403129 12:8194830-8194852 GACAATGCTGTTCAAACTCCAGG + Intergenic
1093466695 12:19456810-19456832 GAGACTGGTGTTCTCAAACCTGG - Intronic
1094750168 12:33397310-33397332 GCCTCTGCTGTTACCACTCCAGG - Intronic
1096528506 12:52228876-52228898 GAGACTAATTTTCCCACTCCAGG + Intergenic
1097020000 12:56013790-56013812 GAAACTGCTGTTCTCAGTCCTGG - Intronic
1098060329 12:66554586-66554608 GCCATTGGGGTTCCCATTCCAGG + Intronic
1099023793 12:77440308-77440330 GACTCTGGCCTTCCTACTCCTGG + Intergenic
1104710016 12:130979084-130979106 GACGCTGGTGTCCCCAGACCTGG - Intronic
1104757282 12:131277102-131277124 AACACTGGTGTCCCGAGTCCTGG - Intergenic
1104757294 12:131277161-131277183 AACACTGGTGTCCCGAGTCCTGG - Intergenic
1104757306 12:131277220-131277242 AACACTGGTGTCCCGAGTCCTGG - Intergenic
1104757319 12:131277279-131277301 TACACTGGTGTCCCGAGTCCCGG - Intergenic
1104990426 12:132621233-132621255 GGCACTGGCGTTCCCATTGCAGG + Exonic
1107338974 13:39385983-39386005 AACACTGGTGTGACCACTCAAGG - Intronic
1107373528 13:39777630-39777652 AACACTGGTGATCCCTCACCAGG - Intronic
1108514883 13:51191684-51191706 GACATTGATCTTCCCACTGCTGG + Intergenic
1108618442 13:52158750-52158772 CTCACTGGTGATCCCACTTCTGG - Intronic
1117669982 14:58096733-58096755 GATTCTGCTGTTCCCACTCGAGG + Exonic
1119678583 14:76574888-76574910 GAGACTGGGGTTCCCAGCCCCGG + Intergenic
1120895900 14:89532004-89532026 GATACTGGTGCTGCCAGTCCAGG - Intronic
1121498285 14:94413011-94413033 GACACTGGTTTCCTGACTCCAGG - Intergenic
1122556847 14:102585223-102585245 GGCCCTGGTGTCCCCACTCCTGG - Intergenic
1126866015 15:52937703-52937725 GAGACTGGTGTTCTCAAACCTGG - Intergenic
1127632772 15:60841959-60841981 GACAGTGCTGTTCTCTCTCCTGG - Intronic
1128299098 15:66553199-66553221 GTTACCGGTGTTCTCACTCCAGG - Exonic
1132529915 16:441704-441726 CACATTTGTGTTCCCACACCAGG + Intronic
1134108859 16:11502141-11502163 GACACTGGTGTCCCAGCTCCAGG - Exonic
1134789875 16:16980169-16980191 GACACGGGTGTGCTCATTCCTGG + Intergenic
1136173975 16:28505130-28505152 GAACATGGTGTGCCCACTCCTGG - Intronic
1136586044 16:31185515-31185537 GAAACCGATGATCCCACTCCTGG + Intronic
1138118704 16:54380923-54380945 AAAACTGGGCTTCCCACTCCAGG + Intergenic
1138746221 16:59366039-59366061 CACACTTGTGTTCCAACTACTGG - Intergenic
1139287725 16:65830448-65830470 GATACTGGTCTTCAAACTCCAGG - Intergenic
1139524435 16:67505469-67505491 CAGACTGGTCTTCCAACTCCTGG + Intergenic
1142680345 17:1544029-1544051 GGCACTGCTGCCCCCACTCCAGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1146442462 17:32909133-32909155 CAGACTGGTGTTCACAATCCTGG + Intergenic
1147893385 17:43733435-43733457 CACACTGGTGTTCACCCACCAGG - Intergenic
1149667628 17:58376841-58376863 GACAGTGGTGTCCTAACTCCTGG - Intronic
1150216557 17:63474712-63474734 CACACTCGTATTCACACTCCGGG - Intergenic
1150811609 17:68361307-68361329 GACTCTGGTGTGCTCTCTCCTGG + Intronic
1151586111 17:75009333-75009355 CAGACTGGATTTCCCACTCCAGG + Intergenic
1154313329 18:13284226-13284248 GAAAGTGGTGTTCCCACCACGGG - Intronic
1156859598 18:41820318-41820340 GACAGTGGTGTTCCAGGTCCAGG - Intergenic
1157312793 18:46564895-46564917 CACACTGGGGTTCCCTCTCAGGG + Intronic
1162919246 19:13890387-13890409 GACCCTGGGGGTCCCCCTCCAGG - Exonic
1163875941 19:19867503-19867525 CACGCTGGTGTTACCACGCCTGG + Intronic
1165853400 19:38864896-38864918 GACACTGGTTTTCCACTTCCTGG - Intergenic
1166269339 19:41704348-41704370 GACACTGGTGTTCCCACTCCTGG - Intronic
1166887532 19:45971375-45971397 CCCACTGCTGTTCCCAGTCCTGG - Intronic
1168259655 19:55186266-55186288 GGCTCTGCTGTTCCCACACCAGG + Exonic
924961856 2:43019-43041 AGCACTGGTGTTCCCACTGGAGG - Intronic
925196294 2:1928877-1928899 GACACTGGGTTCGCCACTCCAGG + Intronic
926523681 2:13949838-13949860 CACACTGATCTTCCCATTCCAGG + Intergenic
927354993 2:22162658-22162680 GAAACTTGGGTTCCCACTCCAGG + Intergenic
928536895 2:32249862-32249884 GACTCTGGAGGTCACACTCCGGG - Exonic
930606232 2:53496231-53496253 TCCACTGGTTTTCCCACTCTTGG + Intergenic
930760749 2:55032816-55032838 CAAACTGGTGTCCCAACTCCTGG - Intronic
931471766 2:62545379-62545401 TTCACGGGTGTTCCCACTGCAGG + Intergenic
934512836 2:94961017-94961039 GACACTGGTGTTCCCTCACTTGG + Intergenic
935801170 2:106697896-106697918 GAGACTGGTGTTCTCAAACCTGG - Intergenic
937295998 2:120810267-120810289 GGGAGTGGTGTTCCCAGTCCAGG + Intronic
939142652 2:138374132-138374154 GAGACTGGTGCTCCCTCTGCTGG + Intergenic
948740914 2:240045436-240045458 CATCCTGGTGTTTCCACTCCTGG - Exonic
948965455 2:241376230-241376252 GACACTGCAGTGCCCACTTCTGG - Intronic
1169404757 20:5314340-5314362 GAAACTGGTGTTTCCATTCTGGG + Exonic
1170706316 20:18747576-18747598 GACACTCCAGTTTCCACTCCTGG + Intronic
1174582156 20:51579697-51579719 GGCACTTGTGTTCTGACTCCGGG - Intergenic
1177606814 21:23390409-23390431 GAGACTGGTGTTCTCAAACCTGG + Intergenic
1178784929 21:35644699-35644721 GACACTGGTATCCCCACTTGGGG + Intronic
1183431545 22:37768917-37768939 GACTCTGGGGTTCCCTCTCTAGG - Intronic
1185018231 22:48358139-48358161 GCCCCTGCTGTTCCCATTCCTGG - Intergenic
949734970 3:7161221-7161243 TACACTGGAGTTGTCACTCCTGG - Intronic
950125731 3:10508766-10508788 GGCACTAGTGTTGCAACTCCAGG + Intronic
950969253 3:17170101-17170123 AAAACAGGGGTTCCCACTCCTGG - Intronic
952092545 3:29907017-29907039 TACACTGGTTTACCCAATCCAGG + Intronic
952873390 3:37921755-37921777 GGAAGTGGTGTTCCCACTGCTGG + Intronic
953052598 3:39359345-39359367 GATACTGGTGTTCTCAAACCTGG + Intergenic
953355083 3:42249074-42249096 GACACTGGTGTTCTGATTCTAGG + Intergenic
953486665 3:43304983-43305005 GACATTTGTGTTTCCTCTCCTGG - Intronic
953877763 3:46676185-46676207 GACACTAGTGTGCCCTTTCCAGG - Intronic
953957070 3:47239940-47239962 CACACTGTTCTTCACACTCCTGG - Intronic
954406567 3:50348526-50348548 GACACTGGTGTCCATCCTCCAGG - Exonic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
962792686 3:138825745-138825767 GAGACTGGTGTTCTCAAACCCGG + Intronic
967989034 3:195117838-195117860 AGCACTGGAGTTCCCATTCCTGG + Intronic
969663701 4:8544996-8545018 GACCCTGGTGCCCCCACTGCCGG - Intergenic
969762900 4:9202840-9202862 GACAATGCTGTTCAAACTCCAGG - Intergenic
975811349 4:78173376-78173398 GACACTGTTGTTCCCTCCCTAGG + Intronic
978155512 4:105485493-105485515 GAGACTGGTGTTCTCAAACCTGG + Intergenic
980021528 4:127715546-127715568 TACACTGATGTTCCCAAGCCTGG - Intronic
984611043 4:181837823-181837845 TATACTGGTTTCCCCACTCCTGG - Intergenic
985969355 5:3362753-3362775 GGCACTGGTGTCCCTACTCCAGG - Intergenic
989165854 5:38433043-38433065 GGCATTGGCCTTCCCACTCCTGG - Intronic
989632059 5:43495635-43495657 GAGACTGGTGTTCTCAAACCTGG - Intronic
998526696 5:142849257-142849279 GACTCTTGTGTTCTCACTCTTGG + Intronic
999188825 5:149731554-149731576 GGCACCGGCGCTCCCACTCCAGG - Intronic
1002643854 5:180643492-180643514 GACACTGGTATTGCCACCCGGGG - Intronic
1003276518 6:4658616-4658638 GCCAGTGGTGTTCCCACCTCAGG - Intergenic
1008505523 6:52226043-52226065 GACATTGGTGTTCCAACTAAAGG - Intergenic
1010228967 6:73518559-73518581 GAGACTGGTGTTCTCAAACCCGG - Exonic
1012472448 6:99587661-99587683 GGTAGTGGTGTTCCCACTTCAGG + Intergenic
1014168563 6:118252898-118252920 GTCACTGGTGGTCCCATTCAGGG + Intronic
1014180242 6:118376468-118376490 GACACTGGTTCTGCCTCTCCGGG + Intergenic
1017651834 6:156590663-156590685 GAGCCTGGTGTTCCCTCTGCTGG + Intergenic
1018491948 6:164302999-164303021 GACACTGTTATGGCCACTCCAGG + Intergenic
1019265663 7:116252-116274 GACACTGGTGAGTCCATTCCTGG - Intergenic
1019346276 7:532264-532286 GACACAGGAGTTCCCCCGCCTGG - Intergenic
1020720664 7:11740561-11740583 GACACAGGTGTTCCCCTTCCTGG + Intronic
1020883779 7:13797347-13797369 GGCACAGGGATTCCCACTCCAGG - Intergenic
1021616904 7:22511177-22511199 GAGACTGGTGTTCTCAAACCCGG - Intronic
1022483677 7:30760974-30760996 CACACAGGTGTTCCCTCTGCTGG - Intronic
1022498248 7:30866536-30866558 CACACTGGTCTTGCCTCTCCAGG - Intronic
1023334886 7:39158641-39158663 GAGAAGGGTGTTCCAACTCCAGG + Intronic
1026366857 7:69656909-69656931 CACACTGGTGTTCACCTTCCTGG + Intronic
1028259158 7:88639814-88639836 GAGACTGGTGTTCTCAAACCTGG + Intergenic
1032460681 7:132108179-132108201 GACACTGCTGGCCCCAATCCTGG + Intergenic
1034276472 7:149826090-149826112 GTCCCTGGTGTGCCCACACCAGG + Intergenic
1034441717 7:151089017-151089039 AGCCCTGCTGTTCCCACTCCTGG + Intronic
1036273033 8:7324766-7324788 GACAATGCTGTTCAAACTCCAGG - Intergenic
1036348315 8:7985582-7985604 GACAATGCTGTTCAAACTCCAGG + Intergenic
1036843586 8:12146049-12146071 GACAATGCTGTTCAAACTCCAGG + Intergenic
1036864959 8:12388368-12388390 GACAATGCTGTTCAAACTCCAGG + Intergenic
1039141852 8:34399496-34399518 GGCACTGGGGCTCCCAGTCCTGG + Intergenic
1040980246 8:53239514-53239536 GACACTACTGTTCCCATCCCAGG - Intronic
1042666463 8:71212076-71212098 GAAACTGGTGTTCCAACTCTTGG + Intronic
1049044563 8:140139203-140139225 GCCACTCCTGTTCCCACTGCCGG + Intronic
1049719000 8:144106999-144107021 CACCCTGTTGTACCCACTCCAGG - Intronic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057504329 9:95620190-95620212 GACACTGGTGGTCTCTCTGCAGG - Intergenic
1060498792 9:124137312-124137334 GACAGCGGTGTTCCCAACCCAGG - Intergenic
1061480471 9:130895567-130895589 GGCACTGGTGTCCCCTCTCCGGG + Intergenic
1061583580 9:131552813-131552835 GACACTTGTGCTGCCACACCTGG + Intergenic
1061784735 9:133020287-133020309 GAGACTGGTGTTCTCAAACCCGG + Intergenic
1061845674 9:133386837-133386859 CACACTGGTGTTCCCACCTGGGG + Intronic
1061893410 9:133634573-133634595 GGCACTGGTGTTCCCAGCACGGG - Intergenic
1062392336 9:136338827-136338849 CACAGTGGCGTTGCCACTCCTGG - Intronic
1186236317 X:7514893-7514915 GACAGTGATGGTCTCACTCCAGG - Intergenic
1187550678 X:20301706-20301728 AACCCTGGTGTTCTAACTCCTGG - Intergenic
1188861666 X:35264566-35264588 GAAACTGGTATTCTAACTCCAGG - Intergenic
1196393448 X:115233888-115233910 GACCCTGGTGGTCCCCATCCCGG - Exonic
1196882513 X:120211593-120211615 GAGACTGGTGTTCTCAAACCTGG - Intergenic
1199981481 X:152922931-152922953 AGCACTGGTGATCTCACTCCAGG + Intronic