ID: 1166269738

View in Genome Browser
Species Human (GRCh38)
Location 19:41706810-41706832
Sequence CTGGTGGACAGGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 511}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166269738_1166269750 16 Left 1166269738 19:41706810-41706832 CCCACTTCCCTCCTGTCCACCAG 0: 1
1: 0
2: 1
3: 49
4: 511
Right 1166269750 19:41706849-41706871 TCCCACCCTGGAGCCTCCCCAGG 0: 1
1: 1
2: 11
3: 55
4: 451
1166269738_1166269752 17 Left 1166269738 19:41706810-41706832 CCCACTTCCCTCCTGTCCACCAG 0: 1
1: 0
2: 1
3: 49
4: 511
Right 1166269752 19:41706850-41706872 CCCACCCTGGAGCCTCCCCAGGG 0: 1
1: 2
2: 13
3: 54
4: 443
1166269738_1166269748 4 Left 1166269738 19:41706810-41706832 CCCACTTCCCTCCTGTCCACCAG 0: 1
1: 0
2: 1
3: 49
4: 511
Right 1166269748 19:41706837-41706859 CGGCAGAGTTCCTCCCACCCTGG 0: 1
1: 0
2: 2
3: 20
4: 194
1166269738_1166269754 18 Left 1166269738 19:41706810-41706832 CCCACTTCCCTCCTGTCCACCAG 0: 1
1: 0
2: 1
3: 49
4: 511
Right 1166269754 19:41706851-41706873 CCACCCTGGAGCCTCCCCAGGGG 0: 1
1: 1
2: 13
3: 64
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166269738 Original CRISPR CTGGTGGACAGGAGGGAAGT GGG (reversed) Intronic
900092667 1:927234-927256 CTGCTTGAAAGGAGGGAACTGGG - Intronic
900160855 1:1222790-1222812 GTGGCTGTCAGGAGGGAAGTGGG - Intronic
900187203 1:1338029-1338051 CTGGTAGGCAGGCGGGAAGCAGG + Exonic
900601288 1:3503842-3503864 CTTGTGCACAGATGGGAAGTGGG + Intronic
900945776 1:5830702-5830724 CTGGGGGACAGGGAGGGAGTGGG - Intergenic
901399450 1:9005978-9006000 GTGGTGGACAGGAGGAAGGCAGG - Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
903558585 1:24211071-24211093 GTGGAGGAGAGGAGGGGAGTAGG - Intergenic
904044260 1:27600776-27600798 GAGGTGTACAGTAGGGAAGTTGG - Intronic
904488605 1:30844282-30844304 TTTGTGGCCAGGAGGGAAGGGGG - Intergenic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904829033 1:33295023-33295045 CTGGTGGGCAGGAGGCAGGCAGG - Intronic
906005095 1:42462359-42462381 CTGATAAACAGGAGTGAAGTGGG + Intronic
906580234 1:46929997-46930019 CTGGGGGACAGCAGGCAGGTGGG + Exonic
906586457 1:46983321-46983343 CTGGTGAAGAGCAGGGAATTGGG + Intergenic
906603491 1:47148893-47148915 CTGGGGGACAGCAGGCAGGTGGG - Exonic
906799968 1:48728324-48728346 CTGGTGGAGAGGAAAGAATTAGG - Intronic
907925155 1:58949061-58949083 CTGGCACACAGTAGGGAAGTAGG + Intergenic
908453656 1:64280961-64280983 CTGGTTGACATGAGGGATGATGG + Intergenic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
911893995 1:103406222-103406244 CTGGTGGGTAAAAGGGAAGTTGG - Intergenic
912309616 1:108607214-108607236 CTGGTGTCCAGGAGGGGAGCTGG - Intronic
913965990 1:143377937-143377959 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
914060364 1:144203545-144203567 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
914118786 1:144762824-144762846 CTGGGGGAGAGGTCGGAAGTGGG + Intergenic
914197044 1:145452955-145452977 CTGGTGCACAGGAGGGTATATGG - Intergenic
915125198 1:153658884-153658906 CAGGTGCCCGGGAGGGAAGTTGG + Exonic
915500178 1:156310610-156310632 TTGGTGGACATGAAGGAACTGGG - Exonic
915599318 1:156912693-156912715 GAGGTGCTCAGGAGGGAAGTAGG - Intronic
915981619 1:160424029-160424051 CTAGGGGACAGGAGGGGACTGGG - Intronic
916488100 1:165277318-165277340 CTGGTGGAGAGTGGGGAGGTGGG - Intronic
919724792 1:200874449-200874471 CAAGTAGACAGAAGGGAAGTGGG + Intergenic
919768680 1:201143454-201143476 CTGGTGGACTGGACGGCAGCAGG - Intronic
919927852 1:202201740-202201762 CTGGTGGATGGGAGGGAAATGGG - Intronic
920852030 1:209634525-209634547 CTGGCGGACCCGAGGGAAGGTGG + Exonic
921036330 1:211382677-211382699 CTGCTGGACTGGAGGGAGGGAGG - Intergenic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
921556266 1:216601663-216601685 CTTGTGGGCAAGAGGGGAGTGGG - Intronic
922344483 1:224684927-224684949 CTGGTGGACAGGACTGGAGCAGG - Intronic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923659483 1:235945918-235945940 CTGGGGGAGAGTAAGGAAGTGGG + Intergenic
924336835 1:242993606-242993628 CCGGTGGGCAGAAGGGATGTGGG - Intergenic
1062955604 10:1538459-1538481 CTGGTAGACGAGAGAGAAGTGGG + Intronic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063145731 10:3293731-3293753 ATGCTGGCCAGGTGGGAAGTTGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1064089676 10:12373015-12373037 CTGGTGGCCACCCGGGAAGTGGG - Intronic
1064160257 10:12939261-12939283 CTGATGGACTGGACAGAAGTTGG - Intronic
1064533040 10:16329589-16329611 CGGGTGGGAAGGAGGGAAGGAGG + Intergenic
1064831880 10:19477896-19477918 ATGGTTGACAAAAGGGAAGTTGG + Intronic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1065115173 10:22477301-22477323 CTGGTGGAGGGGAGGGAACTGGG - Intergenic
1065177682 10:23095408-23095430 CAGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065689166 10:28315512-28315534 GCAGTGGCCAGGAGGGAAGTGGG - Intronic
1066802563 10:39207196-39207218 CCGATGGACAGGTGGGGAGTAGG - Intergenic
1067021823 10:42807181-42807203 CTGGGGAACAGCAGGGACGTGGG - Intronic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1067806312 10:49395639-49395661 GCGGGGGACAGGAGGGAAGGCGG + Intronic
1068001249 10:51336698-51336720 CTTGAGGACAGGAGGCAAGGTGG + Intronic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071600375 10:86956007-86956029 CCGGTGGACGGGAGGGAGGAGGG - Intronic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1072103830 10:92255060-92255082 TTGGTGGGCAGTAGGGAAATTGG - Intronic
1072190383 10:93073019-93073041 CAGCTGGACAGCAGGGAAGGGGG - Intergenic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1073442324 10:103559437-103559459 CTGCTGGACGGCAGGGCAGTTGG + Intronic
1074071539 10:110074769-110074791 TTGGAGGACAGGAGAGAAGGGGG + Intronic
1074120522 10:110490744-110490766 ATGGTGCTCAGGCGGGAAGTAGG - Intergenic
1074438447 10:113454425-113454447 CCGGTGGCCAGGTTGGAAGTTGG - Intergenic
1074707372 10:116146760-116146782 CTGCTGGACAGAAGGGAACGTGG + Intronic
1075198096 10:120378545-120378567 TGGGTGGAAAGGAGGGAGGTAGG + Intergenic
1075324375 10:121519005-121519027 CTGGTGGAGAGAAGGGCAGGAGG + Intronic
1076692577 10:132231215-132231237 CTGGTGGACAGCAGAGCCGTGGG - Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077416983 11:2428584-2428606 GTGGTGGGCATGAGGGTAGTTGG + Intergenic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1078523935 11:12086354-12086376 ACAGTGGACAGGAGGGATGTGGG + Intergenic
1078745918 11:14114185-14114207 TAGGGGGACAGAAGGGAAGTGGG - Intronic
1078754513 11:14196307-14196329 CTTGTGGATGGGAGGGAAGATGG + Intronic
1079029295 11:16973871-16973893 CTGGTCCACAGGGAGGAAGTGGG - Intronic
1079614506 11:22474684-22474706 CTTGTGGATGGGAAGGAAGTTGG + Intergenic
1080302336 11:30798506-30798528 GAGGTGGAAAGGAGGGTAGTGGG - Intergenic
1081235592 11:40643616-40643638 CTGGTGGACGGCAGGGGGGTTGG - Intronic
1081800983 11:45859177-45859199 CTGTTGAGCAGGATGGAAGTGGG - Intronic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1082988702 11:59189060-59189082 CTGCTGGAAAGGAGGAGAGTAGG + Intronic
1083034961 11:59628522-59628544 CGGGTGGGCAGGAGGGAGGGAGG - Intergenic
1083697181 11:64450592-64450614 CTGGTGGTCAGGAGGGGAGGTGG - Exonic
1083977970 11:66139466-66139488 GGGGTGGATGGGAGGGAAGTGGG - Intronic
1084264829 11:67999490-67999512 CTGGTGGGCAGCAGGGCAGGAGG - Intronic
1084742628 11:71149598-71149620 CAGGTAGAGAGGAGGGTAGTAGG + Intronic
1085293636 11:75417978-75418000 CTAGAGGCCAGGAAGGAAGTGGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1087218235 11:95517907-95517929 ATGGGGGACAGAAGGGAACTGGG + Intergenic
1087982174 11:104629098-104629120 CTGGTGGACAAAAGTGAATTTGG - Intergenic
1088577758 11:111288011-111288033 CTGGTGGAGGGGGAGGAAGTGGG - Intergenic
1089115764 11:116093780-116093802 CTGGTGGCCAGAAGGGGAGATGG + Intergenic
1089683968 11:120135113-120135135 CTGGTGGGCAGGAGGGTCTTGGG - Intronic
1089868298 11:121651002-121651024 CTGGTGGGCAGAGGGGAAGCAGG + Intergenic
1090370058 11:126244199-126244221 ATGTTGGACAGGAGTGGAGTGGG - Intronic
1090744581 11:129695943-129695965 CTGGGGGAAAGAAGCGAAGTGGG + Intergenic
1091740884 12:2959687-2959709 GGGGCGGACAGGAGGGAAGCGGG - Intronic
1093642502 12:21543391-21543413 GTGGTGCAGAGGAGGAAAGTGGG + Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1101292673 12:103387563-103387585 CTGGTTGACAAGAGGGATGTTGG - Intronic
1101764327 12:107684195-107684217 CTGGTGGGCAGTGGGGGAGTGGG + Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1103505317 12:121439177-121439199 CTGGTGGGCAGGAGGGAGCTTGG - Intronic
1103619264 12:122176351-122176373 CGAGAGGACAGGAGGGTAGTGGG + Intronic
1104843620 12:131835974-131835996 CTGGAGGTCAGGGCGGAAGTGGG + Intronic
1106416703 13:29551818-29551840 CTGCTGGCCAGCAGGGAAGTGGG - Intronic
1106770109 13:32953558-32953580 ATGTTGGACAGGAGGGAGGCCGG - Intergenic
1108505329 13:51107782-51107804 CTGGTGGACTGCAGTGAACTTGG - Intergenic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1111800038 13:92969902-92969924 CTGGTGAACATGTGGGAAGAAGG + Intergenic
1113677232 13:112215257-112215279 GGGCTGGAGAGGAGGGAAGTGGG + Intergenic
1113732999 13:112655935-112655957 CAGGTGGACAGGAGGTGAGAGGG + Intronic
1115006857 14:28496382-28496404 GTGGTGTGCAGGAGGGAGGTGGG + Intergenic
1116616771 14:47150025-47150047 CTGGTGGCCAGAATGGAAGTGGG + Intronic
1117110946 14:52453894-52453916 ATGGTGGGGAGGGGGGAAGTAGG + Intronic
1117385134 14:55204318-55204340 GTAGTGGTGAGGAGGGAAGTGGG - Intergenic
1117485717 14:56194792-56194814 CTGGTGGAAAGGAGGCTAGAAGG - Intronic
1118748467 14:68790425-68790447 CTGCTGGACAGAAAGGCAGTGGG - Exonic
1119196114 14:72717863-72717885 CTGGTAGAGAGGAATGAAGTAGG - Intronic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1121392654 14:93589431-93589453 CTGGGGGATGGGGGGGAAGTTGG + Intronic
1122375139 14:101252276-101252298 CCGGGGGACAGGCAGGAAGTGGG + Intergenic
1122580886 14:102770939-102770961 CTGGTGGACAGCTGGGGGGTGGG + Intergenic
1122615499 14:103015089-103015111 ATGGTGGCCAGGCTGGAAGTGGG + Intronic
1122625283 14:103082363-103082385 ATGGTGGACGGGATGGATGTTGG + Intergenic
1122650783 14:103225534-103225556 CTGATGGCAAGGAGGGAATTTGG - Intergenic
1123043248 14:105499181-105499203 CTGGTGGTCTGGAGGGGACTCGG + Intronic
1123062646 14:105601223-105601245 CTGGTGGTCATGAGGGTTGTTGG + Intergenic
1124071381 15:26396269-26396291 GTGCTGGACTGGAGGGAAATTGG + Intergenic
1124074746 15:26433964-26433986 CTTGTGGCCAGCTGGGAAGTTGG + Intergenic
1124616368 15:31245243-31245265 CTGGTGCTCAGGAGGGGAGCTGG - Intergenic
1124887616 15:33701653-33701675 GGGGTGGAGAGGAGGGACGTGGG + Intronic
1125388118 15:39160064-39160086 CTGGTGGTCAGGAGGAACATTGG + Intergenic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1128129039 15:65213375-65213397 CTGGTGGCCAGGAGGGAGACGGG - Intergenic
1129512837 15:76137559-76137581 CGGGTGGCCAGCAGGGAAGAGGG + Intronic
1129694293 15:77731825-77731847 GTGCTGGACAGGAGGGAGCTGGG - Intronic
1129747597 15:78035502-78035524 TTTGTGCACAGGAGGGAAGCAGG + Intronic
1129766868 15:78175153-78175175 CTGTTGGACAGAAGGAAAGAAGG - Intronic
1130000506 15:80042300-80042322 TTGGTAGACAGGAAGGAAGGAGG - Intergenic
1130961190 15:88659632-88659654 CTGGGGGACAGTGGGGAAGCAGG - Intergenic
1131094732 15:89648188-89648210 GTGGTGGAGAGGAAGGAAGAGGG - Intronic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1132091369 15:98950275-98950297 CAGGTGGACAGGAGGGAATGAGG + Intronic
1132202419 15:99964119-99964141 CTGGTGGCCAGGAGGGGAGGTGG - Intergenic
1132525979 16:414946-414968 CTGGTGGAGGGAAGGGAAGGAGG - Intergenic
1132626473 16:894036-894058 CTGGTGGACAGGGGACGAGTGGG - Intronic
1132828313 16:1915804-1915826 ACGGTGGAGAGGAGGGAAGGAGG + Intronic
1132836087 16:1954149-1954171 CTGGGGGGCAGGAAGGAAGGAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133398056 16:5464232-5464254 CTGGTGCTCAGGAGAGCAGTTGG + Intergenic
1133525398 16:6600300-6600322 ATGCTGGGCAGGAGGGAAATGGG - Intronic
1134054834 16:11163372-11163394 AGAGTGGAAAGGAGGGAAGTGGG + Intronic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1135055256 16:19226698-19226720 ATGGTGGACAGGCAGGTAGTGGG + Intronic
1138086281 16:54136509-54136531 CTGGTGGACTGAAGGGGAGAGGG - Intergenic
1139323023 16:66130604-66130626 CTCCTGGACAGGAAGGAAGGAGG - Intergenic
1139508347 16:67411059-67411081 GAGGTGGGCAGGAGGAAAGTGGG - Intronic
1140223947 16:73064172-73064194 CTGGGGGGCAGGAGGCAGGTGGG + Intergenic
1140376364 16:74448308-74448330 CTAGTGGAGAGGAGGCGAGTGGG + Intergenic
1140472212 16:75222318-75222340 CTGGTGGCGAGAGGGGAAGTGGG - Intronic
1140673500 16:77303145-77303167 CTGGTGGAGATGAGGGGAGATGG - Intronic
1140708399 16:77653085-77653107 CTGGTCTACAGGAGAGAAGGCGG - Intergenic
1141152207 16:81572096-81572118 CCGGGAGACAGGAGGGAAATGGG - Intronic
1141177960 16:81733079-81733101 CTGGAGGACAGGAGTGAACCCGG + Intergenic
1142122253 16:88392709-88392731 CTGGTGGTGAGCAAGGAAGTGGG - Intergenic
1142147295 16:88497927-88497949 CTGATGGACAGCAGGGAGATGGG + Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1143181997 17:4989136-4989158 CTGGAGGACAGTGGGGAGGTTGG - Intronic
1143875622 17:9988478-9988500 CTGGTGCGCAGGAGGGAACCAGG - Intronic
1143928338 17:10393383-10393405 CAGGTGGACACTGGGGAAGTTGG - Intronic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144764727 17:17726148-17726170 CTTGTGGCCCGGAGGGAAGAGGG + Intronic
1146054855 17:29575936-29575958 CTGGTGAGCAGGGGGGCAGTGGG - Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146484006 17:33228877-33228899 CTGGAGGACAGGGAGGAACTTGG - Intronic
1147190695 17:38736334-38736356 CTGGTGGTCAGGAGTTATGTTGG - Intronic
1148087485 17:45003091-45003113 CTGGTGGACAGAAAGCAAGAGGG + Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148435893 17:47684753-47684775 GTGGTGGAGAGGAGGAAAATGGG + Exonic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1148907592 17:50921103-50921125 CTGGAGGACAGGAGAGACTTTGG - Intergenic
1148935317 17:51160479-51160501 CTGATGGGTGGGAGGGAAGTTGG + Intronic
1149074625 17:52580655-52580677 CTGCTGGATAGGAGTGAAGAAGG - Intergenic
1150593720 17:66585258-66585280 CTGGTTGACAGAAGGGAAGATGG + Intronic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1152225363 17:79090302-79090324 CTGCCGGGCAGGAGGGAGGTGGG + Intronic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153525859 18:5994089-5994111 CTGGTGGACAGGGAGGTAGATGG - Intronic
1153590886 18:6673271-6673293 CTGGTGGCCAGGGAGGAAGATGG + Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154204772 18:12327241-12327263 CGGGTGGACAGGAGGGATCGGGG - Intronic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1155620663 18:27775144-27775166 TTGGTGAACAGGAGAGAAGTAGG - Intergenic
1155852062 18:30786396-30786418 CTGGGGGGCAGGAAGGGAGTGGG - Intergenic
1156751268 18:40458790-40458812 CTGGTGTAGAGAAGGGAAATTGG - Intergenic
1160086685 18:75783159-75783181 TTGCTGGATAGGAGGGAAGAGGG - Intergenic
1160150528 18:76393424-76393446 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160150788 18:76394070-76394092 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160150938 18:76394448-76394470 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160929146 19:1561491-1561513 CTGGTGGGGAGGAGGGAAGCTGG + Intronic
1161040461 19:2108414-2108436 GTGGTGGGCAGGAGTGCAGTGGG + Intronic
1161070278 19:2256404-2256426 CTTGTGGACAGGACGGAGGATGG + Exonic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161431201 19:4233369-4233391 CTGGAGGACAGGTGGGAGGTGGG - Intronic
1161668470 19:5590895-5590917 CTGGTGGAGAGGTGGGAGGTGGG - Intronic
1161979728 19:7624179-7624201 CTGGGGGCCAGCAGGGAAGGAGG - Intronic
1162861617 19:13509852-13509874 CTGTTGGACAGAGGGGAATTTGG + Intronic
1162999329 19:14356227-14356249 GGGGTGGCCAGGAGGGAAGCTGG + Intergenic
1163034879 19:14564584-14564606 GTGGTGGACAGGAGGGGCCTAGG - Intronic
1163064802 19:14785125-14785147 GGGGTGGCCAGGAGGGAAGCTGG - Intergenic
1163577670 19:18120120-18120142 CTGGTGGCCAGAAGGGAACTGGG + Intronic
1163595334 19:18218085-18218107 CTGGTGGACAGGGTGGAGGCAGG + Intronic
1164323926 19:24176127-24176149 GTGGTGGAGAGGGGGGAAGGGGG - Intergenic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165159150 19:33805715-33805737 TTTGGGAACAGGAGGGAAGTTGG - Intronic
1165812483 19:38619937-38619959 CAGGTGGACATGGAGGAAGTAGG + Intronic
1165992214 19:39822926-39822948 AGGGTGGACAGGAGTGAAGGTGG + Intergenic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166529693 19:43535006-43535028 CTGGGGGACAGGAGGGCTGGTGG - Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1167105634 19:47428737-47428759 CTGGGGGAGAGAAGGGTAGTGGG + Exonic
1167377820 19:49120805-49120827 CTGGTGGGCAGTACGGAAGCTGG - Intronic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1168317775 19:55491526-55491548 CTGGTGGGAAGGAGGGAGGGAGG + Intronic
1168414187 19:56158567-56158589 CAGGTGGAAAGGAGGACAGTGGG + Exonic
1202699768 1_KI270712v1_random:155430-155452 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
925073225 2:987747-987769 CTGGAGGACAGGAGGGTTGATGG + Intronic
925105586 2:1287978-1288000 CAGGTGGTCAGGATGGAAGCTGG - Intronic
925949258 2:8895699-8895721 CTGCTGGATAGGAGCGAAGAAGG + Intronic
926222369 2:10944668-10944690 CTGGAGGACAGCAGGGGAGAGGG - Intergenic
927388231 2:22561482-22561504 CTGGTGCAGAGTAGGTAAGTAGG - Intergenic
927741809 2:25577005-25577027 CTTGTGGACAGGAGAGAAAAGGG + Intronic
928114901 2:28539696-28539718 GTGCTGGAAAGGAGAGAAGTGGG + Intronic
928388002 2:30885790-30885812 CTGATGGTGAAGAGGGAAGTTGG + Intergenic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
930312243 2:49755928-49755950 AGGGTGGAAAGGAGGGAAGGGGG + Intergenic
931630886 2:64297647-64297669 CTGGGGGCCAGGAGAGATGTGGG - Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932475390 2:72002820-72002842 TAGGTGGCCAGGAGGGAAGCAGG - Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
932693073 2:73929975-73929997 CTAGTGGAAAGGAGGAAAATTGG + Intronic
932708897 2:74047773-74047795 CTGTCGGACAGGTGGGAAGAGGG - Exonic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
935947814 2:108301902-108301924 CTAGGGGACTGGAGTGAAGTTGG + Intronic
936063584 2:109313829-109313851 GTGGGGGAGAGGAGGGAGGTGGG + Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937811466 2:126204059-126204081 ATGGTGGAGGGGAAGGAAGTGGG + Intergenic
939504594 2:143029972-143029994 ATGGAGGACAGGAGGAAATTTGG + Intronic
941493156 2:166167401-166167423 TGGGGAGACAGGAGGGAAGTGGG + Intergenic
941650068 2:168082923-168082945 CTGGTGAACATGATGGCAGTGGG - Intronic
942293868 2:174499166-174499188 ATAGTGGACAGCAGGGAAGTCGG - Intergenic
942665101 2:178309108-178309130 CTGGTTGAGAGGAGGGTGGTGGG - Intronic
942713470 2:178864582-178864604 CTGTTAAACAGGAGGGAAGCAGG - Intronic
942752549 2:179304237-179304259 CTGGAGAACAGCAGGGAGGTGGG - Intergenic
944923062 2:204435624-204435646 CTGGAGGGCAGCAGGGGAGTGGG - Intergenic
946029236 2:216691940-216691962 GTGGGGGAGAGGAGGGAGGTAGG + Intronic
946228887 2:218279547-218279569 GTGTTGGACAGGAGGGGAGATGG - Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947911680 2:233804754-233804776 CAGGTGGCCAGGAGGGCAGCAGG + Intronic
948486252 2:238283131-238283153 TTGCTGGACAGGAGGCAAGGAGG + Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948530307 2:238599861-238599883 GTGGGGGACAGGAGAGCAGTGGG - Intergenic
948556189 2:238813155-238813177 CTCGTGGACAGGATGCAAGTGGG - Intergenic
948574991 2:238944138-238944160 CTGGTGACCAGGAGGGGAGGTGG - Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
948862783 2:240760994-240761016 CGGGTGGGCAGGCAGGAAGTAGG - Intronic
948915718 2:241034297-241034319 CAGGTGGCCAGGAGGTGAGTGGG - Intronic
1168939776 20:1698868-1698890 TTGGTGGCCAGGAGTGAAGTCGG + Intergenic
1168960063 20:1862895-1862917 TTGGTGGAGAGGAGGGAAGGAGG - Intergenic
1169150386 20:3285002-3285024 GTGGAGGGCAGGAGGGAGGTGGG - Intronic
1169248581 20:4043241-4043263 GAGGTGGACAGGAGGGGACTGGG - Intergenic
1169932341 20:10847997-10848019 CTGGGGGGCAAGAGGAAAGTAGG - Intergenic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1171177322 20:23062309-23062331 CTGGTGGACTGAAGGGCAGCTGG + Intergenic
1172527278 20:35607524-35607546 CTGGTGGGCAGAAGGGCAGACGG - Intergenic
1172872935 20:38147077-38147099 CCGGGGGACAGGAGGGAGATGGG + Intronic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1174436533 20:50510804-50510826 CTGGAGAACAGAAGGGAGGTGGG - Intronic
1175668734 20:60882749-60882771 GGGGTGGACAGGAGGCAAGGAGG - Intergenic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176704367 21:10101049-10101071 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178924408 21:36762797-36762819 CTGGAGGCCAGGATGGAAGTGGG - Intronic
1180137258 21:45869696-45869718 TCGGTGGACAGAAGGGCAGTGGG + Intronic
1181106240 22:20577407-20577429 CTGGTGGGAAGGAGGGAGGGAGG - Intronic
1181487479 22:23240832-23240854 GTGCTGGACAGGAGGGGAGGAGG - Intronic
1181512482 22:23395089-23395111 CTGGAGGGCAGGTGGGATGTGGG - Intergenic
1181553774 22:23655886-23655908 CTGGTGCTCAGGAAGGAATTGGG + Intergenic
1181615248 22:24049827-24049849 CAGGTGGAGAGGTGGGAAGATGG - Intronic
1181766617 22:25096775-25096797 CTTGAGGACAGGATGGAAGGAGG - Intronic
1182044574 22:27264219-27264241 CTGGTGGAAAGGAAGGCAGGTGG + Intergenic
1182257857 22:29050886-29050908 CTGGAGGGCACTAGGGAAGTTGG - Exonic
1182512751 22:30830633-30830655 CTGGGGGACAGGTGAGGAGTGGG - Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183708922 22:39491209-39491231 CTGGTGGGCAAGCGTGAAGTGGG + Exonic
1184238573 22:43199749-43199771 CTGCTTGAGAGGAGGGAGGTTGG + Exonic
1184471020 22:44696428-44696450 CTGGCTGACAGGTGGGAAGGTGG + Intronic
1184740329 22:46424604-46424626 GCTGGGGACAGGAGGGAAGTGGG - Intronic
1184781718 22:46652936-46652958 CTGGTGGGCAGGAGGCAGGCCGG + Intronic
1184816981 22:46879982-46880004 GTTGTGGACAGGAGGGCAGGTGG + Intronic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184920851 22:47604771-47604793 ATGATGGACAGGAGGGCAGCAGG + Intergenic
949374293 3:3370040-3370062 CTCGGGGAAAGGATGGAAGTGGG - Intergenic
949538934 3:5017307-5017329 AAGGTGGACAGGAGAGAAGTTGG + Intergenic
949867145 3:8555415-8555437 CTGGAGGACAGGAGGGTAAGAGG + Intronic
949928462 3:9059941-9059963 CTGGTGTCCAGGAGGGTACTTGG + Intronic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
950696526 3:14704957-14704979 CTAGTGGAGAGGAGAGAATTAGG + Intronic
951670059 3:25171182-25171204 GTGGAAGACAGGAAGGAAGTAGG - Intergenic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952530967 3:34261224-34261246 TTGGTGGAAAGGAGGCAAATTGG - Intergenic
954456207 3:50601109-50601131 CTGGTGACCTTGAGGGAAGTAGG - Intergenic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954599389 3:51856154-51856176 CTGCTGGACAGGGGTGAAGAAGG - Intergenic
954668631 3:52275420-52275442 CTGGTAGTTAGGAGGGAACTGGG - Intronic
954918406 3:54168194-54168216 CTGGTGGAAATGAGGTCAGTGGG + Intronic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955425373 3:58783995-58784017 GTGGTGGAAGGGAGGGAAGGAGG - Intronic
955455685 3:59118895-59118917 CTGGTGGAGATGAGGGGATTTGG - Intergenic
955656144 3:61247008-61247030 ATGGAGGACAGGAGGGAGGGAGG - Intronic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
958531038 3:95330370-95330392 CTGGGGGGCAAGTGGGAAGTGGG - Intergenic
959503245 3:107130913-107130935 CTGGAGGTCAGAAAGGAAGTGGG + Intergenic
960699845 3:120429000-120429022 CTGCTGGCCAGGAAGAAAGTGGG + Intronic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961315883 3:126035350-126035372 CTGGTGATGAGGAGGGAAGGAGG + Intronic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961443389 3:126966087-126966109 CAGGTGGCTAGGAGGGGAGTGGG + Intergenic
962369042 3:134805535-134805557 CTGCTGGGCAGGAGGGCAGGAGG - Intronic
962884231 3:139608881-139608903 TTGGGAGACAGGAGAGAAGTGGG - Intronic
963854456 3:150239230-150239252 ATTGTGGACAGGAAGGAAGTGGG + Intergenic
965402589 3:168230726-168230748 TTGTTGGACAGCAGGGAGGTTGG - Intergenic
965916583 3:173855849-173855871 ATGGTGGCCAGGTGGCAAGTTGG + Intronic
966007747 3:175037188-175037210 CTGGAGGACAAGTGGGAAGCTGG - Intronic
968007598 3:195254010-195254032 CTGGTGCACAGCTGGGCAGTGGG - Intronic
968423419 4:504368-504390 GAGCTGGAAAGGAGGGAAGTGGG + Intronic
968609680 4:1551297-1551319 CCGGTGGGCAGGTGGGAGGTGGG + Intergenic
968799508 4:2732977-2732999 CTGGTGGACAGGATGCAGGTAGG + Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970214860 4:13748269-13748291 CTCTTAGACAGTAGGGAAGTTGG - Intergenic
970469464 4:16362245-16362267 CTGGTGGCCAGTAGGAAAGGAGG + Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
971920296 4:32930642-32930664 CTGATGGACAGTGGGGAATTCGG - Intergenic
972379555 4:38506344-38506366 GTGGAGGACAGAAGGGAAGCAGG + Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972575658 4:40348995-40349017 CTGGTTGTCAAAAGGGAAGTAGG - Exonic
973717263 4:53689545-53689567 ATGGGGGACAGGTGTGAAGTAGG - Intronic
973919150 4:55667126-55667148 CTGGGGGGCAGGAGGGAATGGGG - Intergenic
974475600 4:62375175-62375197 ATGGTGGCTAGGAGGGAAGATGG + Intergenic
975728225 4:77313184-77313206 CTGGTTTACAGGAGGAAACTTGG + Intronic
975740160 4:77421990-77422012 CTGTTGCACAGTAGGGCAGTAGG - Intronic
975747787 4:77491939-77491961 CTGGTGGACAGGAGATGAGGTGG - Intergenic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
977166423 4:93704589-93704611 GTGGTGGGAAGAAGGGAAGTGGG - Intronic
977640751 4:99355606-99355628 CTGCTGGATAGGAGCGAAGAAGG - Intergenic
978375892 4:108075289-108075311 CATGTGAACAGGAGGGAAGCAGG - Intronic
979200163 4:117968035-117968057 ATAGTGGACAGGATGGGAGTGGG - Intergenic
980376579 4:131957383-131957405 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
982135448 4:152270581-152270603 CTGGTGAAAAGGAGGCAAGCTGG + Intergenic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985365497 4:189227361-189227383 CTGGTGGACAGGAGGATTTTAGG - Intergenic
985677177 5:1238183-1238205 CTGGTGGTCAGGGGTGAGGTTGG + Intronic
986721723 5:10564875-10564897 GTGGTGGGGAGGAGGGGAGTGGG - Intronic
987451890 5:18095176-18095198 CTGGTTGTCAGGAGGTAGGTAGG + Intergenic
989612903 5:43312842-43312864 TTGATGGAAAGAAGGGAAGTGGG - Intronic
990081016 5:51913705-51913727 CTGGTGGAGAGAAAGGAAGAGGG + Intergenic
990446836 5:55901214-55901236 GTGTTGGACAGGCGGGAACTAGG - Intronic
990751288 5:59019562-59019584 TTGCTGGAGAGGAGGGTAGTGGG - Intronic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992219636 5:74558945-74558967 TTGGTGGAGTGGAGGGAAGGGGG + Intergenic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994774239 5:104024389-104024411 CTGGTGGGCAGTTGGGAACTGGG - Intergenic
997394933 5:133552125-133552147 GTGGAGGGCAGGAGGGAAGGTGG - Intronic
997658070 5:135569892-135569914 CAGGTGGACAGGTGGACAGTAGG - Intergenic
998446946 5:142205872-142205894 CTAGTGGCCAGGAGGGGAGGTGG - Intergenic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000224838 5:159250470-159250492 CTGGGCCACAGAAGGGAAGTGGG - Intergenic
1000993522 5:167935370-167935392 CTGATGGACAGGACTGATGTGGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001720779 5:173855361-173855383 CTGTTGGCCAGGAGGGAAAAAGG - Intergenic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002330576 5:178437699-178437721 CAGGTGAGCAGCAGGGAAGTAGG - Intronic
1002456908 5:179350505-179350527 CTGGAGGAGAAGTGGGAAGTGGG - Intergenic
1003949210 6:11102804-11102826 CCGGAGGAGAGGAGGGAATTTGG + Exonic
1003957292 6:11175524-11175546 CTGGCGCACAGCAGAGAAGTGGG - Intergenic
1004008844 6:11661702-11661724 CTAGTGGGGAGGAGGGAAGTAGG - Intergenic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006434671 6:34020011-34020033 GAGGTGGACAGGAGGGAACCAGG - Intronic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1006923890 6:37643748-37643770 CTGGAGGATGGGAGGGGAGTGGG - Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1010018382 6:71130950-71130972 GTGGTGGGCAGGAGGGAAGTGGG - Intergenic
1010175621 6:73024869-73024891 CTGGTGGGAAGGTGGGCAGTGGG - Intronic
1010783832 6:79976708-79976730 GTGGTGGAGAGGTAGGAAGTAGG - Intergenic
1011233607 6:85190880-85190902 CTACTGGAAAGGAGGTAAGTGGG - Intergenic
1011381052 6:86742533-86742555 GTAGTGGACAGGAGGGGAGAAGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1013176337 6:107680493-107680515 CTGGTGGGCAGGAAGCAGGTGGG + Intergenic
1014146641 6:118005581-118005603 GTGGAGGACAGGAGAGAAGGAGG - Intronic
1014286719 6:119507332-119507354 CTGGAGGAGAGAAGGGAAGGAGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1018219836 6:161566774-161566796 CTGGTGGAGGGGAGGGGAGGAGG - Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018721266 6:166574310-166574332 CTGCTGGGGAGGAGGGAAGGAGG - Intronic
1019194318 6:170272359-170272381 CTGGAGGACAGGGGGGCTGTCGG + Intergenic
1019275701 7:174440-174462 ACGGTGGACAGCAGAGAAGTGGG + Intergenic
1019398385 7:835972-835994 CTGCTGGACAGGCGGGAAGAAGG + Intronic
1019437300 7:1028672-1028694 ATGGGGGAGATGAGGGAAGTAGG - Intronic
1019462234 7:1166573-1166595 CTTGTGGTCAGCAGGGAAGAAGG + Intergenic
1019637881 7:2086100-2086122 CTGCTGGCCAGGAGGGAGGGAGG - Intronic
1019804957 7:3116972-3116994 TTGGTGGTGAGGAGGGGAGTGGG + Intergenic
1019809911 7:3157782-3157804 ATGAAAGACAGGAGGGAAGTCGG + Intronic
1019823106 7:3260725-3260747 CTGAGGGCCAGGAGGGAATTTGG - Intergenic
1019950676 7:4369842-4369864 CTGCTGGCCAGGAGGTAGGTAGG - Intergenic
1020648088 7:10840659-10840681 TTGGGGTCCAGGAGGGAAGTTGG + Intergenic
1022038206 7:26554096-26554118 CCTGTGGATAGGAGGGAAGATGG - Intergenic
1022041752 7:26588151-26588173 CTGGTGGGGAGGAGGGAGGCTGG + Intergenic
1022282938 7:28928934-28928956 ATGGTGCACAGTAGGGAAGCAGG + Intergenic
1022959457 7:35412776-35412798 GTGGTGGACAGGATGTAAGGTGG + Intergenic
1023422376 7:39995533-39995555 CTGGAAGACAGGTAGGAAGTAGG - Intronic
1023855455 7:44180605-44180627 CTTGTGGCCAGGAGGGGAGGTGG + Intronic
1023956627 7:44891820-44891842 CCAGTGGAGAGGAGGGAAGTTGG + Intergenic
1024388804 7:48783812-48783834 CTGATGGCCAGGAGTGAATTAGG - Intergenic
1024575836 7:50763621-50763643 CTGGGGGAGAGGAGGGATTTGGG - Intronic
1024963776 7:55004494-55004516 CTGGTGGCTTGGAGGGACGTTGG + Intergenic
1026734458 7:72940906-72940928 CTTGGGGCCAGGAGGGAGGTGGG - Exonic
1026784790 7:73295814-73295836 CTTGGGGCCAGGAGGGAGGTGGG - Intergenic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1027109286 7:75424114-75424136 CTTGGGGCCAGGAGGGAGGTGGG + Exonic
1027655800 7:80929766-80929788 CTGTGTGACAGGAGTGAAGTGGG - Intergenic
1027870649 7:83702583-83702605 CTGGTAGACTGGAGGGAAATGGG - Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1030031473 7:105373814-105373836 CTGATGGGCAGGTGGGAAGCTGG - Intronic
1030749696 7:113216291-113216313 CTGGAGGTAAGGAGGCAAGTTGG - Intergenic
1031187367 7:118500087-118500109 GGTGTGGACAGGAGGGAGGTGGG - Intergenic
1032488475 7:132306092-132306114 CTGGTGGTCAGGACAGAAGGAGG + Intronic
1032859112 7:135860994-135861016 CTTGTGGAGAGGAGAGAAGAGGG + Intergenic
1033231801 7:139604072-139604094 CTGGCGGACTGGAGGTAAGCAGG - Exonic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1034429359 7:151033547-151033569 CTGGTCAGCAGGAGGGCAGTCGG + Intronic
1034571456 7:151959766-151959788 CTGGTGGCCAGGAGGGTACTGGG + Intronic
1035637286 8:1156336-1156358 CTGGTGGCCCGGAGGAGAGTTGG + Intergenic
1035689886 8:1553189-1553211 CCTGAGGACAGGAGGGAAGGAGG - Intronic
1036207248 8:6814452-6814474 ATGGTTGCCAGGAGGGAAGGAGG + Intronic
1036740464 8:11356751-11356773 CTAGTGGACAGGAGGGTGCTGGG + Intergenic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1038023883 8:23572048-23572070 GTGGTGGACAGGAAGGACTTGGG + Exonic
1038820007 8:30943493-30943515 CTAGTGGCCAGGAGGGGAGGGGG + Intergenic
1039421165 8:37442392-37442414 ATGGAAGACAGGAGGGAAGAAGG - Intergenic
1041166532 8:55097988-55098010 CTGGTGAACAGCAAGGGAGTTGG + Intergenic
1042030635 8:64471945-64471967 CAGGTGAACAGGAAGTAAGTAGG + Intergenic
1042803967 8:72751892-72751914 ATGGAGGCCAGGAGGGAAGAAGG + Intronic
1043001923 8:74770024-74770046 CTGGTAGATGGGAGGGAAGGAGG + Intronic
1044552126 8:93524362-93524384 GTGGTGGAAAAGATGGAAGTTGG - Intergenic
1044837754 8:96312833-96312855 CTGGGGCAGAGGAAGGAAGTGGG - Intronic
1044893141 8:96858570-96858592 CTGGTGGGCAGGAAGCAAATGGG - Intronic
1045388098 8:101690186-101690208 CTTGTGGAGAGGAGGGGAGGGGG + Intronic
1045981014 8:108187344-108187366 CAGGTGGTCAGAAGGGAAGATGG - Intergenic
1047016087 8:120724862-120724884 AGTGTGAACAGGAGGGAAGTAGG + Intronic
1047188302 8:122655440-122655462 CTGGTGGCCAGGAGAGGAGGTGG - Intergenic
1047189753 8:122667350-122667372 CAGGTGGCCAGGTGGGAAGAGGG - Intergenic
1048845771 8:138602609-138602631 CTGCAGGCCAGGTGGGAAGTAGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049218927 8:141420091-141420113 CTGGTGGGCAGCTGGGAAGGGGG + Intronic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1049693951 8:143974678-143974700 GGGGAGGGCAGGAGGGAAGTGGG - Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050019665 9:1269787-1269809 CTTGAGAACAGGAGGGCAGTGGG + Intergenic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1051019548 9:12525729-12525751 CTGGTGACCAGGAGGGCAGGTGG - Intergenic
1051345704 9:16148982-16149004 TTGGGGAATAGGAGGGAAGTGGG - Intergenic
1051721187 9:20039293-20039315 CTGGTGTACTGCAGGGGAGTGGG + Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053641628 9:40088065-40088087 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1053764507 9:41377399-41377421 CTGGTGGACCTGTGGGAAGAGGG + Intergenic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053872668 9:42508804-42508826 CTGGTGGTCAGTGTGGAAGTCGG - Intergenic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054269660 9:62957948-62957970 CTGGTGGTCAGTGTGGAAGTCGG + Intergenic
1054322516 9:63685454-63685476 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1054543123 9:66288576-66288598 CTGGTGGACCTGTGGGAAGAGGG + Intergenic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1054822504 9:69537544-69537566 CTTCTGGAAAGGAGGGAAGGAGG + Intronic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056028556 9:82526356-82526378 CTGGTGGTCAGGAGAGAAAGTGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056992554 9:91424412-91424434 GGGGTGGGCAGGAGGGAAGGCGG + Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057254526 9:93534253-93534275 GTGGGGGACAGGAGGGGAGGTGG + Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057310523 9:93940284-93940306 CTGGTGGACAGCACGGAAAATGG - Intergenic
1057412008 9:94825127-94825149 ATGGAGGAGAGGAGGGAAATTGG + Intronic
1057674407 9:97127339-97127361 CCTGGGGGCAGGAGGGAAGTGGG + Intergenic
1057832070 9:98414825-98414847 CTGGTTGACAGGGGGGAAAACGG - Intronic
1059491818 9:114674216-114674238 TGGGTGGACAGGAGGGAAGAAGG - Intergenic
1059531193 9:115037113-115037135 CTGATGGGGAGGAGGGATGTTGG - Intronic
1059694943 9:116722109-116722131 CTGGTAGACAGCTGGGAAGAGGG - Intronic
1060760098 9:126239759-126239781 TGGGTGGACAGGATGGAGGTGGG + Intergenic
1061230725 9:129314294-129314316 CGGGAGGACAGTGGGGAAGTGGG - Intergenic
1061547169 9:131311113-131311135 CTGGTGGCAAGGAAGGAACTGGG + Intergenic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1062245393 9:135563395-135563417 CAGGTGGACAGGTGGGTAGGTGG + Intronic
1062340971 9:136093924-136093946 CTGGAGAACAGGAGGGAAGGAGG + Intronic
1062697690 9:137883887-137883909 CTGGTGCACAGGAGGGTATATGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1202789404 9_KI270719v1_random:71151-71173 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1185818504 X:3179691-3179713 CTGGTGGACAGGATTGAATTTGG + Intergenic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1189698594 X:43692908-43692930 CTGGTGGAAATTAGGGAATTAGG + Intronic
1190202854 X:48378926-48378948 ATGGTGGACGGGAGGAGAGTGGG + Intergenic
1190207684 X:48416487-48416509 ATGGTGGACGGGAGGAGAGTGGG - Intergenic
1192888056 X:75358036-75358058 CTGGTGGAGCGGAGGGAAAATGG + Intergenic
1193312466 X:80024493-80024515 CTGGTGGTCAGAAGGGAAGCGGG + Intronic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193487371 X:82103130-82103152 CTTGAGGAGAGGAGAGAAGTCGG - Intergenic
1193487659 X:82107094-82107116 CTTGAGGAGAGGAGAGAAGTAGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1199977196 X:152901030-152901052 GTGGTGGCAAGGAGTGAAGTGGG + Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1201261795 Y:12165718-12165740 TTGGTGGACAGGATTGAATTTGG - Intergenic
1201430428 Y:13896965-13896987 CTGCTGGACAGGAGTGATGAAGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic
1201743587 Y:17348156-17348178 CTGCTGGACAGGAGCAAAGAAGG + Intergenic
1201774126 Y:17645742-17645764 CCTGAGGACAGGAGGGAATTTGG + Intergenic
1201827431 Y:18260247-18260269 CCTGAGGACAGGAGGGAATTTGG - Intergenic
1202388022 Y:24343527-24343549 CCGGTGGAGAGAAGGGATGTGGG + Intergenic
1202482765 Y:25326601-25326623 CCGGTGGAGAGAAGGGATGTGGG - Intergenic