ID: 1166270694

View in Genome Browser
Species Human (GRCh38)
Location 19:41711684-41711706
Sequence CCATGGCAATGAGCCATGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166270694 Original CRISPR CCATGGCAATGAGCCATGCG GGG (reversed) Intronic
900138685 1:1129573-1129595 CCACGGCACTGAGCCACGCATGG + Intergenic
900720320 1:4171826-4171848 CCTGGGCCAGGAGCCATGCGAGG + Intergenic
904834753 1:33328233-33328255 ACATGGCACAGAGCCCTGCGTGG - Intronic
919051518 1:192517051-192517073 ACATGTAAATGAGCCTTGCGTGG + Intergenic
920376378 1:205510550-205510572 CCTTGGGAAGGAGCCATGCCAGG - Intronic
924421043 1:243910442-243910464 CCATGGAGATGATCCATGCTTGG - Intergenic
1067581575 10:47449851-47449873 CCAGGGCACTGAGCTCTGCGGGG + Intergenic
1076673622 10:132136486-132136508 CCAAGGCCATGAGCCAGGAGTGG + Intronic
1078262112 11:9719390-9719412 CCATGGCAGTTAGCCAGGTGTGG + Intronic
1084632069 11:70359407-70359429 CCATGGCAATGGAGCATGGGAGG + Intronic
1088763910 11:112958541-112958563 CCATGGCAAGGAGACAAGCTAGG - Intergenic
1089162818 11:116452587-116452609 CCTTGGCAGTGAGACATGCCAGG - Intergenic
1090598242 11:128342549-128342571 CAATGAGAATGAGCCATGCTTGG + Intergenic
1092912326 12:13157752-13157774 GCATGGCAATGAGCAGTGAGGGG - Intergenic
1096418193 12:51432116-51432138 CCTTGGAAATGGGCCAGGCGCGG + Intronic
1097970526 12:65628322-65628344 CCATGGGAATGAGGCATGTCAGG - Intergenic
1100267992 12:92996647-92996669 CCATGTTAATGAGCCATGTTTGG + Intergenic
1101826481 12:108224393-108224415 CCATGGCAATGCCCCATTCAGGG - Intronic
1113339682 13:109409799-109409821 CCAAGGGAATGAGCCAGGCAGGG + Intergenic
1113345783 13:109477066-109477088 CAAGGGCAATAAGCCATGCAAGG + Intergenic
1115913731 14:38286120-38286142 CAATGGCAATAAGCAATGAGTGG + Intergenic
1116903715 14:50385513-50385535 TCATGGCAATGGGCCAGGCGTGG + Intronic
1119024747 14:71143633-71143655 CCAAGACATTGAGCCATCCGGGG + Intergenic
1121790379 14:96695128-96695150 CCATGCCACTGACCCATGCTGGG + Intergenic
1122760801 14:104024137-104024159 ACATAGCATTGAGCCAAGCGTGG + Intronic
1130793387 15:87180772-87180794 CAAAGGTAATGAGACATGCGGGG - Intergenic
1132759015 16:1500011-1500033 CCAAGGCCAAGAGCCATGCCAGG - Intronic
1132837645 16:1962465-1962487 CCATGGCTATGCCCCATGTGTGG + Intronic
1146425483 17:32733481-32733503 CCTTGGCACTCAGCCATGGGTGG - Intronic
1151359750 17:73581782-73581804 CCAGGGCAATGAGCCCCGAGTGG + Intronic
1152651332 17:81494828-81494850 CCCTGGCAATGAAGCATGCTTGG - Intergenic
1157569573 18:48703692-48703714 CCATGGAATTGAGCTCTGCGGGG + Intronic
1166270694 19:41711684-41711706 CCATGGCAATGAGCCATGCGGGG - Intronic
925282483 2:2694501-2694523 CCAGGGCAAGGAGCCATGTGGGG - Intergenic
927319973 2:21732295-21732317 CGATAGAAATGAGCCATGAGGGG + Intergenic
927899335 2:26808020-26808042 CCATGGCAATGAGGCCAGCCAGG + Intergenic
928308051 2:30187413-30187435 CCATGGCTATGCCCCATGCGTGG - Intergenic
930016216 2:46972584-46972606 CCATGGCAATCAGCTAAGTGTGG - Intronic
933167412 2:79091842-79091864 CCATGGCCATGATCAATGGGTGG - Intergenic
934968061 2:98740294-98740316 CCAAGGCTATGAGCCATCCTAGG - Intergenic
936522324 2:113219122-113219144 CGAGGGCAATGAGACATGCCAGG - Intronic
937997589 2:127706731-127706753 CCATGGCCATGAGCCAGGAAGGG - Intronic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
938249039 2:129799462-129799484 GCATGGCAATGAGCAAGGCTGGG + Intergenic
946024769 2:216665177-216665199 CCTTTGCAATGGGCCATGGGGGG + Intergenic
1170662160 20:18352578-18352600 CCATGGAAAAGGGCCAGGCGTGG - Intergenic
1177769717 21:25500832-25500854 CCATGGGAATGAGCCATCTTGGG + Intergenic
1179884135 21:44306272-44306294 GCATGGCAATCAGGCATGTGTGG - Intronic
1181556045 22:23672186-23672208 CCATGGCAGTCAGCCATGAGGGG + Intergenic
1181698334 22:24606467-24606489 CCATGGCAGTCAGCCAGGAGGGG - Intronic
1182221874 22:28765063-28765085 TCATGGCAATGATCCATGAGGGG - Intergenic
1182325224 22:29507512-29507534 ACATGGAAATTAGCCAAGCGTGG - Exonic
1184388745 22:44190971-44190993 CCATATCCCTGAGCCATGCGTGG + Intronic
1185039488 22:48497143-48497165 CCATGGAAATCAGCCCTGCCAGG + Intronic
950581440 3:13864937-13864959 CCATGGCAATGTCCGAAGCGAGG + Intronic
950636239 3:14317190-14317212 CCCTGGTAATGAGCCAGGGGGGG - Intergenic
951105439 3:18736614-18736636 CCATGGCCTTTAGCCATGCAAGG - Intergenic
956029545 3:65022921-65022943 CCATGACAATGATCCATGCGAGG - Intergenic
961673313 3:128549958-128549980 CCATGGCATTTAGCCAAGAGAGG + Intergenic
962796623 3:138855217-138855239 CCATGGAAAGGAGCCAGGCGTGG - Intergenic
962828729 3:139121333-139121355 CCAGGGCAATGAGAAATGAGTGG - Intronic
968719964 4:2194726-2194748 AAATGGCAATTAGCCAGGCGTGG + Intronic
971910453 4:32789293-32789315 TCATGGCAAACAGCCATGCATGG + Intergenic
976055520 4:81061116-81061138 CCATGGGGAAGAGCCATGAGAGG + Intergenic
991595948 5:68305697-68305719 CCAAGGCAAAGAGCCAAGTGAGG - Intergenic
991913492 5:71584131-71584153 CAATGGGAATGAGCAATGCATGG + Intergenic
998545319 5:143022803-143022825 CCCTGGCAATGAGGCAGGCTAGG - Intronic
998549849 5:143066984-143067006 CCATGGAAATCAGCCCTACGTGG - Intronic
1001140343 5:169138745-169138767 CCATGCAAGTGTGCCATGCGTGG - Intronic
1006996671 6:38267575-38267597 CCAAGGTCATTAGCCATGCGTGG - Intronic
1007336820 6:41160403-41160425 CCATGGTAAAGAGCCATACTGGG + Intronic
1010340834 6:74750577-74750599 CCTTGGCAATGAGCACTGCCAGG - Intergenic
1011546014 6:88482031-88482053 CCCTTGCATTGAGCGATGCGAGG - Intergenic
1014291435 6:119563164-119563186 CCATGGCAATTACCAATGTGGGG - Intergenic
1016323614 6:142875189-142875211 CAATGACAAGGAGCCATGCAGGG + Intronic
1018726031 6:166614161-166614183 GCATGGCAGGGAGCCATGAGTGG - Intronic
1034257694 7:149733535-149733557 CCAGGGCCATGAGCCCAGCGAGG - Exonic
1034312742 7:150103544-150103566 CCATGGCAATGAAACATGACAGG - Intergenic
1034794119 7:153997124-153997146 CCATGGCAATGAAACATGACAGG + Intronic
1036577856 8:10045195-10045217 CCATGTCAAGGTGCCATGCATGG + Intergenic
1043821759 8:84874633-84874655 CCTTGGCAGTGAGCCATACAGGG + Intronic
1044373750 8:91445438-91445460 CCATGGCCATGAGCCTTAGGAGG - Intergenic
1044952482 8:97447716-97447738 CCATGGCCATGAGCCTTCTGAGG - Intergenic
1048691037 8:136963608-136963630 CCTTGACAATGAGCCATGACTGG + Intergenic
1056809662 9:89754495-89754517 CCATTGGAATGAGCCATGGCTGG + Intergenic
1057780710 9:98047773-98047795 GCATGGAAATGAGCCGGGCGTGG + Intergenic
1060939657 9:127536081-127536103 CCCTGCCAAGGAGCCATCCGTGG - Intronic
1062309178 9:135926769-135926791 CCATGGCACTGGGCCCTGCCTGG - Intergenic
1194259210 X:91672967-91672989 CCAGGACAATGAGCCATACACGG + Intergenic
1196821171 X:119702166-119702188 AGATGGTAATGAGCCAGGCGTGG + Intergenic
1197221397 X:123917212-123917234 TAATGGCAATGAGCAATGTGGGG - Intergenic