ID: 1166273534

View in Genome Browser
Species Human (GRCh38)
Location 19:41734310-41734332
Sequence TGTCAAATCCTGAGAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 3, 1: 1, 2: 3, 3: 18, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166273534 Original CRISPR TGTCAAATCCTGAGAGTAGA GGG (reversed) Intronic
902416684 1:16243920-16243942 TGACAAATCCTGAGATTCTAAGG - Intergenic
903473259 1:23602081-23602103 TGCCAAATACTGAGACTCGATGG + Intronic
903817656 1:26076501-26076523 TTTCTAATCCTGAGAGTCAAGGG + Intergenic
904910620 1:33931600-33931622 TGTCAAATCCTGCTTCTAGAAGG - Intronic
906155527 1:43611941-43611963 AGTCAAAGCCTGAGAATAGATGG + Intronic
906594281 1:47060618-47060640 TGTCTAATACTGACAGTGGAGGG - Intergenic
906948212 1:50313645-50313667 TGTGAGATCCTAAGAGGAGAGGG + Intergenic
907410513 1:54280192-54280214 TGTTAACTCCTGAGAGAAGAGGG - Intronic
908557489 1:65271048-65271070 GGTCAAAACCTGAGACTGGAGGG - Intronic
909214488 1:72868831-72868853 TGTCAGCTCTTGACAGTAGATGG + Intergenic
915274635 1:154779719-154779741 TGGCAAATGCTGAGGGTAAATGG + Intronic
916184311 1:162115967-162115989 TGTCAAATACTCAAAGTAGAAGG + Intronic
916752486 1:167735987-167736009 TGTCAAATAGTGAGAGGAGGAGG - Intronic
917385122 1:174464342-174464364 GTTTAATTCCTGAGAGTAGATGG - Intronic
920699677 1:208208426-208208448 TGTCAAATAATGAGAGTATTGGG + Intronic
922342501 1:224669074-224669096 GGTGAAATCCAGAGAGGAGAAGG - Intronic
923106360 1:230856941-230856963 TGTCAAAAGCTGAAAGAAGAGGG - Intronic
923861009 1:237892019-237892041 TGGCAAATCCTGTGAGTAAATGG - Intergenic
924897764 1:248361059-248361081 TGTCCAATACTGTGGGTAGAAGG + Intergenic
1063418367 10:5890697-5890719 GGTCAAAACGTCAGAGTAGACGG - Intronic
1064655538 10:17551862-17551884 TGTCAGATCCAGTGAGTTGAAGG - Intergenic
1065384480 10:25120672-25120694 TGTCAAATCCAGAGACTAACAGG - Intergenic
1065974410 10:30829810-30829832 TGTCAGCACCTGAGAGAAGATGG + Intronic
1068338718 10:55673083-55673105 TGTCACATCGTGAGAGTGAAAGG + Intergenic
1068918464 10:62458940-62458962 CTTCAAATCCTGAGAGTAGCTGG + Intronic
1074304410 10:112263336-112263358 TATAAAATCCTGAGAATAAATGG + Intergenic
1074321888 10:112410906-112410928 TGTCAAATCAAGAGAGTGGTGGG - Intronic
1075045012 10:119139795-119139817 TGTCAATTCCTGAGACTGGGAGG + Intergenic
1075127810 10:119714812-119714834 TGTCAAATAATGAGCCTAGAGGG + Intergenic
1078921459 11:15834866-15834888 TGTCACCTCCTCAGAGTAGCAGG + Intergenic
1081727845 11:45344225-45344247 TTTCAAATCCTCAGACTAGAGGG + Intergenic
1084620832 11:70269486-70269508 AGTCAAATCCTGGGAGGAGTGGG + Intergenic
1084937372 11:72594333-72594355 TGCCAGATCCTGAGGGCAGAGGG - Intronic
1086983694 11:93226104-93226126 TGCCAGATCCTAAGAGCAGAGGG + Intergenic
1089452306 11:118607261-118607283 TGTTAAAGCCTGGGAGTGGAGGG + Intronic
1089724992 11:120468917-120468939 TGTGAAATTCTGAGGGGAGAAGG + Intronic
1090052490 11:123391947-123391969 TGACAAATTCTGAGGGCAGAGGG + Intergenic
1091870377 12:3884983-3885005 TCCCAAATCCTGAATGTAGATGG - Intergenic
1096001133 12:48131534-48131556 TTTCAAATGCTAAGAGTAAAGGG - Intronic
1098146333 12:67501346-67501368 TTTCAGATCCTAAGAATAGATGG + Intergenic
1106049180 13:26174785-26174807 TGTAAAATCCTGGCAGTTGAGGG + Intronic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1108855958 13:54792569-54792591 AGTCTCATCCTGAGAGTGGATGG - Intergenic
1109793106 13:67275546-67275568 TCTCAAATCCCGAGAACAGAGGG + Intergenic
1113257228 13:108519452-108519474 AGTCAAATCCGCAGATTAGAAGG - Intergenic
1116967313 14:51028116-51028138 TATAAAATCCTGGGACTAGATGG - Intronic
1117136460 14:52739225-52739247 TATCGAATCCTGATGGTAGAGGG + Intronic
1118384550 14:65244908-65244930 TCTCAGATCCTGACAGTAGAGGG - Intergenic
1120122381 14:80697032-80697054 AGTGAAATCCTGTTAGTAGACGG + Intronic
1126059006 15:44760787-44760809 TGTTAGAGGCTGAGAGTAGAAGG - Intronic
1130322664 15:82853793-82853815 TGTCAAGGTCGGAGAGTAGAGGG + Intronic
1132314160 15:100878832-100878854 GGTCAAGTCCTGGGAGTTGATGG + Intronic
1135542665 16:23344273-23344295 TGTTAAACCCGGAGATTAGAAGG + Intronic
1136185336 16:28585164-28585186 TTTCGAATCCTCAGAGTAGAGGG - Intronic
1140860549 16:79014041-79014063 TGTCAATTCCTGAGAGCCGCTGG + Intronic
1143844313 17:9762185-9762207 TGTCACATCCTGAGTGCACACGG - Intergenic
1147517255 17:41131789-41131811 TCTCACATCTAGAGAGTAGAGGG + Intergenic
1151140448 17:71986464-71986486 TGTCAAGTGCAGAGAGAAGATGG + Intergenic
1152902126 17:82948367-82948389 GGTCTAATCCTGGGAGTGGAAGG - Intronic
1154960583 18:21304762-21304784 TGTCAATAACTGAGAGGAGAGGG + Intronic
1155711426 18:28885404-28885426 TGTCAAATTCTCTGAGTTGAAGG - Intergenic
1156519513 18:37710134-37710156 TTTCAAACCCTGAGGGTGGATGG - Intergenic
1157524779 18:48372630-48372652 TGTCATATCCTGAGGGCAGTGGG - Intronic
1161760446 19:6167325-6167347 TGTAAAATGGGGAGAGTAGAGGG + Intronic
1164658876 19:29944986-29945008 AGTGACATCCTGAGTGTAGAAGG + Intronic
1164853363 19:31502475-31502497 TTTCTCATCCTGAGAGTTGAAGG - Intergenic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1166273534 19:41734310-41734332 TGTCAAATCCTGAGAGTAGAGGG - Intronic
1166278602 19:41774154-41774176 TGTCAAATCCTGAGAGTAGAGGG - Intergenic
1166398012 19:42456712-42456734 TGTCAAATCCTGAGAGTAGAGGG + Intergenic
1166413851 19:42577507-42577529 TGTCAAATCCTGAAAGTAGAGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166450730 19:42898410-42898432 TGTCAAATCCTGAAAGTAAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166561329 19:43734183-43734205 GGTCCAATCCTGACAGTTGAGGG - Intronic
1167501262 19:49850068-49850090 AGACAAATCCTGAAAGTAGAAGG - Intergenic
925856492 2:8134415-8134437 TGTGCCATCCTGAGAGTGGATGG + Intergenic
927478894 2:23434873-23434895 TGTCAAAGCCTGAGAGGGGGTGG + Intronic
927500017 2:23576442-23576464 TGTCATCTGCTGAGATTAGAAGG + Intronic
927684931 2:25163933-25163955 TGCCAAATCCAGAGATTAAAAGG - Intronic
930228054 2:48814354-48814376 TGTGAAAACTGGAGAGTAGATGG - Intergenic
935091333 2:99897706-99897728 TGTCAAATGATGATAGAAGACGG - Intronic
935662203 2:105476772-105476794 AGCCAGATACTGAGAGTAGAAGG + Intergenic
938844898 2:135198130-135198152 TGGCAGATCCTGAGTGCAGAAGG - Intronic
939112918 2:138029488-138029510 TGTAAAATACTGCTAGTAGATGG - Intergenic
939459068 2:142476083-142476105 TGTCACATGATGAGAGTAGGAGG + Intergenic
941267952 2:163386920-163386942 TGTCAACTCCTGTGACTAAATGG + Intergenic
941268355 2:163392515-163392537 TGTCAAATCCAGAGATTCAAAGG + Intergenic
941813069 2:169773444-169773466 TTTCAAATCTTGTTAGTAGATGG + Intronic
942597412 2:177604637-177604659 TGACAAATCCTACCAGTAGAGGG - Intergenic
942648022 2:178135815-178135837 TGTAGAATCCTGAGAGACGAGGG - Intronic
942993189 2:182227968-182227990 TCTCTAATACTAAGAGTAGAAGG - Intronic
945364303 2:208931881-208931903 TGTTCAATTCTGATAGTAGATGG + Intergenic
945432399 2:209779359-209779381 TGTGAAAATCTGAGTGTAGAAGG - Intronic
945904860 2:215580502-215580524 TTACAAATCCTTATAGTAGAAGG + Intergenic
946745487 2:222841237-222841259 TGTCAAATCCTGAGCCTGGGAGG + Intergenic
948035035 2:234851616-234851638 TGTCACATGATGAGAGAAGAAGG - Intergenic
948287509 2:236797729-236797751 TATCAAAGCATCAGAGTAGAGGG + Intergenic
1169806597 20:9566330-9566352 TGTCAGACCCTGACAGTGGAGGG + Exonic
1169964338 20:11198176-11198198 TGCCAAATATTGAGAGTTGAGGG + Intergenic
1170787460 20:19479871-19479893 TCTCAAAACCTGAGTGTAGCTGG - Intronic
1174095741 20:48088173-48088195 ACTCAAATGCTGAGAGTAGTGGG + Intergenic
1177093637 21:16802253-16802275 TGTCAAAAGCTGAGAGTCGTCGG - Intergenic
1181259562 22:21587690-21587712 ACTCAAGTCCTGAGAGGAGATGG - Intronic
1183758820 22:39796943-39796965 TGTCTAATCCTGAGAGCAGGAGG + Intronic
1183910116 22:41072690-41072712 TCTCACACACTGAGAGTAGAGGG + Intergenic
949156635 3:835043-835065 TGTTAAATCCTAAGATTAGTTGG + Intergenic
951554854 3:23910901-23910923 AGTGATATCCTGAGAGAAGATGG - Exonic
956563020 3:70603291-70603313 TGTGAAAGCCTCAGAGCAGAAGG - Intergenic
956690020 3:71868020-71868042 TGTCAATTACTGAGAAAAGAAGG - Intergenic
956976309 3:74584477-74584499 CGTCACATGGTGAGAGTAGAAGG - Intergenic
957547981 3:81664493-81664515 TGTCCAAACCTGAGAGCAGCTGG + Intronic
957634899 3:82769894-82769916 GGTGAAATCCAGAGATTAGATGG - Intergenic
958226701 3:90832806-90832828 ATTCAACTCCTGAGAGTTGAAGG - Intergenic
958789683 3:98637027-98637049 TGTCTAAGGCTGAGAGTAGGGGG - Intergenic
960396769 3:117147129-117147151 TGAAAAATAATGAGAGTAGAAGG - Intergenic
964293222 3:155204688-155204710 GGTCATATGCTGAGAGTAAAAGG - Intergenic
966016278 3:175141463-175141485 TTTCAAATAGAGAGAGTAGAGGG + Intronic
966140306 3:176749482-176749504 TATCAAATACTGAGAATAAAAGG + Intergenic
966197625 3:177329090-177329112 TGTCACATCCTCAGATTATATGG + Intergenic
966290319 3:178348742-178348764 TGTCTAAGGCTGAGAGAAGACGG - Intergenic
969995040 4:11303222-11303244 TTTCAAAGCCTGAGAATAAAGGG - Intergenic
970385675 4:15554231-15554253 TTTCAACTCCTCAGAATAGAAGG + Intronic
971990749 4:33890292-33890314 TGCCAAGGCCTGAGAGAAGAGGG - Intergenic
973211216 4:47617683-47617705 GGCCAAATCCTTAGAGTAGATGG + Intronic
975773939 4:77762777-77762799 TGTCAAGGGCTGAGAGAAGAAGG + Intronic
977673057 4:99717672-99717694 TATCAAAACATCAGAGTAGAAGG + Intergenic
978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG + Intergenic
979090897 4:116480825-116480847 TGTCAAAAGCTGAGCTTAGATGG - Intergenic
983080178 4:163375575-163375597 TGTCAATTTTTGAGAATAGAGGG - Intergenic
983483827 4:168309959-168309981 TGCCAACTCCTGAGACTCGAAGG + Intronic
984352135 4:178608723-178608745 TGACACAACCTGAAAGTAGAGGG - Intergenic
984689083 4:182705329-182705351 TGTGAAGTCCTTGGAGTAGAGGG - Intronic
984760233 4:183357126-183357148 TGTTATTTCCTGAGAGTGGAGGG - Intergenic
985891707 5:2720761-2720783 TGCCAAATCGTCAAAGTAGAGGG + Intergenic
989506420 5:42231212-42231234 TTCCCAATCCTGAGAGTAGTAGG + Intergenic
989989119 5:50740158-50740180 TGCTAAATCCATAGAGTAGAAGG - Intronic
990250375 5:53907860-53907882 TCTGAAATACTGAGTGTAGAGGG - Intronic
990408754 5:55519034-55519056 TGTCAAATCCTGAGGAAAGGGGG + Intronic
994458873 5:100049165-100049187 TGTTAAGTCCTGTGAGTAGGAGG + Intergenic
995136867 5:108688469-108688491 TGTCTCAACCTGAGAATAGAAGG + Intergenic
995868410 5:116717847-116717869 TTTTAAATCCTGGGACTAGAAGG + Intergenic
995913787 5:117218811-117218833 TATCAAATCCTGAGGCTAAAAGG - Intergenic
996673389 5:126146688-126146710 TAGCAAATCCTGACAGTAAATGG + Intergenic
997259577 5:132455745-132455767 GGTCAAATCCTGGGAGGAGTGGG - Intronic
997671386 5:135677031-135677053 TGTCTAATGCTAATAGTAGAGGG + Intergenic
999681237 5:154062323-154062345 TGTCATTTACTGAGAGAAGACGG - Intronic
1000457490 5:161469639-161469661 TGTCTAATACTCAGAGGAGATGG + Intronic
1000702781 5:164473859-164473881 ATTCAAATCCAGACAGTAGAAGG - Intergenic
1000944827 5:167408219-167408241 TTTCAACTCCTAAAAGTAGAAGG + Intronic
1003554532 6:7128027-7128049 TCTGAAAACCTGAGAGTACAAGG - Intronic
1004829058 6:19457827-19457849 TTTCTAGTCTTGAGAGTAGAAGG - Intergenic
1006824961 6:36928156-36928178 TGTCAAATCCTGACAGTTCCAGG - Intronic
1007242889 6:40439637-40439659 TGTCACTTCCTGAGAGTGTATGG - Intronic
1007388653 6:41536844-41536866 GGTAAAACCATGAGAGTAGATGG + Intergenic
1008739328 6:54586158-54586180 GGTCTATTTCTGAGAGTAGATGG - Intergenic
1009908592 6:69898956-69898978 TGCCCTATCCTGAGAATAGAGGG + Exonic
1010328948 6:74599181-74599203 TGGCTAATACTGAGGGTAGAGGG - Intergenic
1011353973 6:86454447-86454469 GTTCCAATCCTGAGATTAGAGGG + Intergenic
1012803927 6:103870701-103870723 TGACAAAACGTGAGAGTTGAAGG - Intergenic
1012814658 6:104007712-104007734 TTTCAAAACCCCAGAGTAGAAGG + Intergenic
1014314722 6:119849186-119849208 TGTAAAATCCTGATGGTAGTAGG + Intergenic
1015324598 6:131909946-131909968 TGGTAAATCCTGATTGTAGATGG + Intergenic
1016623441 6:146139389-146139411 TGTCCAATGCTGAAAGTACAGGG + Intronic
1017035045 6:150259488-150259510 TGACAATTCCACAGAGTAGAAGG + Intergenic
1022975857 7:35556448-35556470 AGTCAAATCATGAGAAAAGATGG + Intergenic
1026367596 7:69664845-69664867 TGTGAGATCCTTAGATTAGAAGG + Intronic
1026428721 7:70322912-70322934 TGTAAAGTGCTGAGAGTGGAAGG - Intronic
1028756300 7:94438525-94438547 TCTCAAACTCTGAGAGTACATGG - Intergenic
1030152264 7:106419453-106419475 TGTTAAATGCTGGGAATAGAAGG + Intergenic
1031202598 7:118708214-118708236 TGAGAAATCCTGAGTGTAAAAGG - Intergenic
1031291097 7:119936195-119936217 TGTAAAATGCAGAGGGTAGAAGG + Intergenic
1031757287 7:125661089-125661111 TGTGAAATCATGTGAGAAGAAGG + Intergenic
1031839620 7:126721937-126721959 TTTCAAATCCTGGGATTAGGAGG - Intronic
1033880507 7:145876621-145876643 TATCAAATCTGAAGAGTAGAGGG - Intergenic
1033958169 7:146878283-146878305 TGGCAAACCCTGGGAGGAGAGGG + Intronic
1034344223 7:150376416-150376438 TGTCAAAGCCTGGGAGCAGAGGG + Intronic
1035241197 7:157530534-157530556 TGCCAAATCCTGAGGGAAGATGG - Intergenic
1037474102 8:19239249-19239271 TGTCAAATCCTGAATGAAGAGGG + Intergenic
1039376454 8:37039247-37039269 TGGGAAATTCTGAGAGTGGAAGG + Intergenic
1039611588 8:38923536-38923558 TTTCATTTCCTGAGAATAGAAGG + Intronic
1039807892 8:41018002-41018024 TCTCAGATCAGGAGAGTAGAGGG - Intergenic
1041688947 8:60670721-60670743 TTTCAAGTGTTGAGAGTAGAAGG - Intergenic
1044792832 8:95865158-95865180 TGTCAGAGTCTGAGAGGAGAAGG + Intergenic
1049404858 8:142447799-142447821 TGTCAAAGCCTTGGAGAAGAAGG + Intergenic
1052345544 9:27405894-27405916 TCTCAAAACCTGAGTATAGAAGG + Intronic
1055034051 9:71799128-71799150 TGCCAAATGTTGAGAGTATAGGG + Intronic
1055443890 9:76363758-76363780 TGTTTAATCCTGACAGTAAATGG + Intergenic
1055444019 9:76364916-76364938 TGTTTAATCCTGACAGTAAATGG - Intergenic
1055509466 9:76981494-76981516 TGTCAAGGGCTGAGGGTAGAAGG - Intergenic
1059056971 9:110993537-110993559 TGTCAAAGCCTGAAAGGTGAGGG + Intronic
1060300788 9:122373541-122373563 AGTCAAGTCCAGAGACTAGAGGG - Intronic
1060391760 9:123283567-123283589 TATCAAATCATGAGACTGGATGG - Intergenic
1187073577 X:15912241-15912263 TGTTAAATAGTGATAGTAGAGGG + Intergenic
1191644146 X:63461667-63461689 TGTCAAAACCTGAGAATAGATGG - Intergenic
1191735975 X:64388124-64388146 TGGCAAATCAGGACAGTAGATGG - Intronic
1193489148 X:82126745-82126767 TGTCACATGGTGAGAGTAGGAGG + Intergenic
1194406625 X:93504022-93504044 TGTTAAAGTCTGAGAGTTGAAGG + Intergenic
1194419376 X:93654015-93654037 TGTCAAATACTGCAAGTGGAAGG - Intergenic
1194734709 X:97498139-97498161 TGGCAAATCATAAGAATAGAAGG - Intronic
1195135002 X:101896888-101896910 TGTTAAATCCTGAAAATACAGGG - Intronic
1196547236 X:116976174-116976196 TGCCAACTCTTGAGAGTAGCTGG + Intergenic
1196898462 X:120360651-120360673 TTTCAAAAACTGAGAGTAGGGGG - Intergenic
1197030310 X:121804928-121804950 TCTCAAAACCTGAGTATAGAAGG - Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1197758043 X:130009974-130009996 TTTCAAATCCTCTGAGAAGAGGG - Intronic
1200970386 Y:9146489-9146511 TGTAAAATACTGAGATCAGAAGG + Intergenic
1202140623 Y:21717833-21717855 TGTAAAATACTGAGATCAGAAGG - Intergenic
1202146242 Y:21785964-21785986 TGTAAAATACTGAGATCAGAAGG + Intergenic