ID: 1166281671

View in Genome Browser
Species Human (GRCh38)
Location 19:41798278-41798300
Sequence GAATCCTAGGGGGACCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166281671 Original CRISPR GAATCCTAGGGGGACCCCTC AGG (reversed) Intronic
900916808 1:5645108-5645130 GAATCCCAGTGGGAATCCTCAGG - Intergenic
909605073 1:77499744-77499766 GACTCCTAGAGAGACCCCTTGGG + Intronic
912373667 1:109192970-109192992 GTATGCTAGGGGGAGCACTCGGG - Intronic
916726244 1:167526497-167526519 GAATCCTGGGAGGGCCCCTTGGG - Intergenic
922773338 1:228201760-228201782 GAATCCTCTGGGGACCTCACAGG + Intergenic
1069609021 10:69759917-69759939 GAGCCCTTGGGAGACCCCTCTGG - Intergenic
1069625988 10:69867929-69867951 GCATTCTGGAGGGACCCCTCAGG - Intronic
1074773803 10:116751541-116751563 GAATGCTATAAGGACCCCTCAGG + Intergenic
1076754048 10:132558836-132558858 GATTCCCAGGTGGAACCCTCAGG + Intronic
1085042812 11:73336575-73336597 GAGTCCCAGCTGGACCCCTCTGG + Intronic
1087046941 11:93850449-93850471 GAGTCCTAGGGAGATGCCTCGGG + Exonic
1097180285 12:57167879-57167901 GAGTCCTTGGTGCACCCCTCAGG + Intronic
1104964325 12:132502244-132502266 GAATCCTTGGCAGACCCCACTGG + Intronic
1105704459 13:22960711-22960733 GGATTCTAAGGGGACCCCTGAGG - Intergenic
1105857409 13:24385762-24385784 GGATTCTAAGGGGACCCCTGAGG - Intergenic
1108721297 13:53135576-53135598 GAATTCTAAGGGGAGCCCTGGGG - Intergenic
1112850815 13:103704463-103704485 GAATTCTTGTGGGACCCCTAGGG - Intergenic
1130667265 15:85880203-85880225 GAATCCTATGGGGATCACCCAGG - Intergenic
1131666868 15:94580262-94580284 AAATCCTAGGGGGAGCCCCGTGG + Intergenic
1132976214 16:2712386-2712408 GGATCCTTGGGGGACCCCGGCGG - Intergenic
1141044880 16:80707079-80707101 GAATCCTAGGGGGCAGGCTCTGG - Intronic
1141339975 16:83194234-83194256 CAATCCACGGGGGCCCCCTCTGG + Intronic
1143627010 17:8116306-8116328 GAATCCTAGCAGCACCTCTCAGG + Intronic
1151694349 17:75706522-75706544 AAGTCCTAGGGTGGCCCCTCAGG - Exonic
1151946872 17:77324375-77324397 GACTCCTTGCTGGACCCCTCTGG + Intronic
1161321387 19:3643264-3643286 GTCTCCGAGGGGGACCGCTCAGG + Exonic
1161349285 19:3783413-3783435 GACTCCTCTGGGGACCCCCCAGG - Intronic
1161568501 19:5016881-5016903 GCAGCCCAGGGGGACCACTCAGG + Intronic
1163436908 19:17301396-17301418 GCAGCCCAGGGGGACCTCTCCGG - Exonic
1166276417 19:41757289-41757311 GGTCCCTAGGGGGACCCCTCAGG - Intronic
1166281671 19:41798278-41798300 GAATCCTAGGGGGACCCCTCAGG - Intronic
925708594 2:6715450-6715472 GCACCCTAGGGTGACCGCTCAGG + Intergenic
934524815 2:95045274-95045296 GAATCCCAGTGGGACCCCGTGGG - Intronic
935775105 2:106466220-106466242 GAGTCCTGGGGGGACCGCTGCGG - Intronic
1171015344 20:21536419-21536441 GAATTCTAAGGGGGCCCCTGAGG + Intergenic
1172115634 20:32571935-32571957 GAATCTTTGGGGGATCCCTGAGG + Intronic
1172914732 20:38435054-38435076 GAATCCTGGGGGGCTCACTCCGG + Intergenic
1175750736 20:61495419-61495441 GAAGCCTTGGGCGACCTCTCAGG - Intronic
1175805465 20:61826099-61826121 GCATTCTAGAGGGACCCCTTGGG - Intronic
1179122428 21:38560289-38560311 AGATCCTAGTGGGACACCTCTGG - Intronic
1179790605 21:43753984-43754006 GAATCCTGGTGGGACCCCCATGG - Intronic
1181425486 22:22834969-22834991 ATATACTAGGGGGACCTCTCTGG - Intronic
1182487158 22:30646489-30646511 GAAGCCTACCCGGACCCCTCGGG - Intronic
1184748856 22:46472819-46472841 GGCTCCTAGGTGCACCCCTCTGG + Intronic
1184872857 22:47251909-47251931 GAGGCCTAGGGGAAGCCCTCTGG + Intergenic
952791488 3:37204053-37204075 GAATCCTTGGGGAAAGCCTCAGG + Intergenic
952872729 3:37916164-37916186 AAATCCCAGGCGGACCTCTCTGG + Intronic
954962465 3:54578474-54578496 GCATCCTTGGGGTCCCCCTCGGG + Intronic
955879545 3:63529153-63529175 GTATCCATGGGGGACCCCTGGGG + Intronic
960548270 3:118943157-118943179 CAATGCTGGGAGGACCCCTCTGG - Intronic
960938561 3:122918723-122918745 GAAGCCTCAGGGGTCCCCTCAGG - Intronic
963247439 3:143075812-143075834 GAATCCAAGAGGGACCTCTCAGG + Intergenic
964344909 3:155745345-155745367 GAAACCCAGGGTAACCCCTCGGG + Intergenic
974036473 4:56822027-56822049 CAGTCCTAGGGGGACCCTTGTGG + Intergenic
977637485 4:99316089-99316111 CAATCCTCGGGGGACCCTGCAGG - Exonic
977639879 4:99345053-99345075 CAATCCTCGGGGGACCCTGCAGG - Exonic
977671243 4:99698145-99698167 GTGCCCTAGGAGGACCCCTCAGG + Intergenic
982349531 4:154399832-154399854 GAAACCTAGGGGGATCCCTCTGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003884597 6:10510198-10510220 GAATGCTAGTGGGGGCCCTCTGG - Intronic
1007756254 6:44101626-44101648 GACCCCTGGGGGGACCCCTGGGG - Intergenic
1015115383 6:129643278-129643300 GAGTCCTGGGGGGACCCAACAGG + Intronic
1019621607 7:1995208-1995230 GAAGCCTCGGGGGGCACCTCGGG + Intronic
1020134080 7:5576459-5576481 GAAGCCCAGGGGGACAGCTCCGG + Intergenic
1024082634 7:45867692-45867714 GACTCCTAGGTGCAGCCCTCAGG - Intergenic
1035203264 7:157279745-157279767 GAGTCCTCGGGGGTCCCCACCGG + Intergenic
1038700974 8:29849012-29849034 GAACCCTGGGGGGAGCCCTGGGG - Intergenic
1040763703 8:50880849-50880871 GAAGCCTAGTGGGATCGCTCGGG + Intergenic
1042354067 8:67806735-67806757 GAATCCAAAGGAGAACCCTCAGG + Intergenic
1046660015 8:116938659-116938681 GACGCCTTGGGGGGCCCCTCAGG + Intronic
1048114629 8:131507972-131507994 GAATACTATGGGGACCACGCAGG + Intergenic
1049328608 8:142037944-142037966 AAATGCTGGGGAGACCCCTCAGG + Intergenic
1053311582 9:37024199-37024221 GATACCTAGGGGAACCGCTCAGG + Intronic
1062674199 9:137730698-137730720 CCAGCCTAGGGGGACCCCACTGG - Intronic
1196857691 X:119999559-119999581 GAGTCCTGGGCGGACTCCTCAGG + Intergenic