ID: 1166281874

View in Genome Browser
Species Human (GRCh38)
Location 19:41799574-41799596
Sequence AGTCAGTGCCAGGAATGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166281869_1166281874 5 Left 1166281869 19:41799546-41799568 CCTAGAACTAAATCCCTTGTGTC 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1166281874 19:41799574-41799596 AGTCAGTGCCAGGAATGTCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1166281868_1166281874 10 Left 1166281868 19:41799541-41799563 CCTAACCTAGAACTAAATCCCTT 0: 1
1: 0
2: 0
3: 22
4: 255
Right 1166281874 19:41799574-41799596 AGTCAGTGCCAGGAATGTCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1166281870_1166281874 -8 Left 1166281870 19:41799559-41799581 CCCTTGTGTCAACAGAGTCAGTG 0: 1
1: 0
2: 2
3: 17
4: 140
Right 1166281874 19:41799574-41799596 AGTCAGTGCCAGGAATGTCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1166281871_1166281874 -9 Left 1166281871 19:41799560-41799582 CCTTGTGTCAACAGAGTCAGTGC 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1166281874 19:41799574-41799596 AGTCAGTGCCAGGAATGTCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1166281867_1166281874 23 Left 1166281867 19:41799528-41799550 CCTAACACATTAGCCTAACCTAG No data
Right 1166281874 19:41799574-41799596 AGTCAGTGCCAGGAATGTCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166281874 Original CRISPR AGTCAGTGCCAGGAATGTCC GGG Intronic
904046123 1:27609592-27609614 AGTCAGGTCCAGGAAGGGCCTGG - Intergenic
906291607 1:44623041-44623063 GGTCAGAGCCAAGAATGGCCTGG + Intronic
906626515 1:47330291-47330313 AGTCATTTCCAGGAATGACAAGG - Intergenic
911376593 1:97058670-97058692 ACTATGTGCCAGGAATGTACTGG + Intergenic
913553130 1:119936321-119936343 AGCCAGTGGCAGGAATCTCTGGG + Intronic
913559629 1:120004645-120004667 AGCCAGTGCCCTGAATGTCTAGG + Intronic
913638231 1:120785896-120785918 AGCCAGTGCCCTGAATGTCTAGG - Intergenic
914280217 1:146164066-146164088 AGCCAGTGCCCTGAATGTCTAGG + Intronic
914418293 1:147504880-147504902 ACTCAGTTGCAGGAATGTCCTGG + Intergenic
914541262 1:148615005-148615027 AGCCAGTGCCCTGAATGTCTAGG + Intronic
914625378 1:149456240-149456262 AGCCAGTGCCCTGAATGTCTAGG - Intergenic
914705439 1:150166298-150166320 ATTCAGAGCCAAGAATGTGCTGG + Intergenic
919341325 1:196311292-196311314 AGTAAGTGTCAGGATTGTACAGG - Intronic
919654077 1:200180637-200180659 AGGCTGTGCCAGGAAAGACCTGG - Intergenic
920011551 1:202871656-202871678 AGCCAGTGCCAAGACTGTACAGG + Intergenic
922109592 1:222543976-222543998 AGTCCTTGTCAGGAAGGTCCAGG + Exonic
923853377 1:237820533-237820555 AGGCAGTGGAGGGAATGTCCCGG - Intronic
1064469009 10:15616011-15616033 AGTCAGTGTATGGAATGTCCAGG + Intronic
1066046480 10:31599899-31599921 AGGCAGTGGGAGGAATGTCGGGG - Intergenic
1067836893 10:49646944-49646966 AGCCTGTGCCAGGAAGGTCTGGG + Intronic
1070600399 10:77862286-77862308 GGTCAGTGGAGGGAATGTCCAGG - Intronic
1072542371 10:96407764-96407786 AGTCAGTGCCAGGAAAAAACAGG + Intronic
1077746731 11:4915210-4915232 AGTCATTGGCAGGATTGGCCTGG - Exonic
1078354547 11:10624291-10624313 AGTCACTGCCCGGAATGACAGGG - Intronic
1079029310 11:16973921-16973943 AGACAATGGCAGGAATGTCCTGG - Intronic
1079983936 11:27180204-27180226 AGGCAGTGCAGGGTATGTCCCGG + Intergenic
1082642595 11:55683268-55683290 AGTCAGTGTCAGAAATGTCATGG - Intergenic
1082758037 11:57097300-57097322 AGTCAGTCCCAGGACTGTTGCGG - Intergenic
1083842030 11:65310073-65310095 AGCCAGGGCCTGGACTGTCCTGG - Intergenic
1084502766 11:69544648-69544670 AGTCTGTGCCAGGCCTGCCCTGG + Intergenic
1084615270 11:70231646-70231668 TGTCTGTGCCAGGCACGTCCTGG + Intergenic
1084962425 11:72724223-72724245 AGTCAGTGTGAGGCATGTCTGGG - Intronic
1085205490 11:74729726-74729748 AGGCTGTGCCATGTATGTCCTGG + Intronic
1085712498 11:78842655-78842677 TGTGAGTGCCTGGTATGTCCAGG - Intronic
1088825875 11:113493901-113493923 ATTTAGTGCCAGGAAAGTCTTGG - Intergenic
1089741594 11:120588365-120588387 AGTAAGTACCAGGTATGTGCTGG - Intronic
1089858027 11:121564288-121564310 AGGCAGGGGCAGGAATGTCTAGG - Intronic
1093072976 12:14725673-14725695 ATTCAGTGGCTGTAATGTCCAGG + Intergenic
1093194629 12:16115478-16115500 AGACAGTCCCATGAAAGTCCTGG - Intergenic
1094006072 12:25752927-25752949 AGCCAGGGATAGGAATGTCCTGG + Intergenic
1094648237 12:32348644-32348666 AGTTATTGCCTGGAATGTCCTGG - Intronic
1096180080 12:49545896-49545918 TGTCACTGCCCGGAGTGTCCTGG - Intronic
1100797172 12:98194767-98194789 AGTCAGGGCCAGGAAAGTACAGG - Intergenic
1109800658 13:67373255-67373277 AGTGAGTGACAGAAAAGTCCAGG - Intergenic
1110717953 13:78729544-78729566 AGTCAGTCCCAGGAAGATCTGGG - Intergenic
1112900653 13:104353244-104353266 ATTCAGGGCCAAGAATGGCCAGG - Intergenic
1119644089 14:76336176-76336198 AGCCATTGCCAGGTAGGTCCAGG + Intronic
1119804017 14:77470542-77470564 AGTCAGGGCGAGGCTTGTCCAGG - Intergenic
1121812171 14:96900901-96900923 AGTCATTGCCAGGCATGTCACGG + Intronic
1122955335 14:105067769-105067791 GGTCAGAGCAAGAAATGTCCAGG + Intergenic
1122996523 14:105268288-105268310 AGTCTCTGCCCGGCATGTCCAGG + Intronic
1123432241 15:20228569-20228591 AGTCAGCACCAGAAATGTTCGGG + Intergenic
1125152655 15:36550712-36550734 AGTCACTGCTAGGAATTTCCTGG - Intergenic
1129364027 15:75043491-75043513 AGAGGGTGACAGGAATGTCCTGG - Exonic
1129426299 15:75465666-75465688 AGTGAGTGACAGGATTATCCAGG - Exonic
1130105564 15:80926071-80926093 AGTAAGTGCCTAGAATGTTCTGG - Intronic
1132554132 16:565202-565224 AGCCACTGCCAGGAATGACAGGG - Exonic
1132654897 16:1037661-1037683 TGGTAGTGCCAGGAAGGTCCCGG + Intergenic
1135955874 16:26955817-26955839 AGGCACTGCCAAGACTGTCCAGG - Intergenic
1138355316 16:56373136-56373158 ATTCAGTGCCAGGAGTGATCAGG + Intronic
1139472542 16:67185894-67185916 ACTCTGTGCCAGTAATGTCTGGG - Intronic
1141508764 16:84499030-84499052 GGTCAGTGCCAGGCAGGTCTTGG - Intronic
1141758441 16:86010794-86010816 AGTCACTCCCAGGCATGGCCAGG - Intergenic
1142186663 16:88698018-88698040 AGCCAGGGCCAGGAATGAACAGG + Intronic
1142874783 17:2845072-2845094 AGTCAGTGCCATACATGTGCAGG - Intronic
1146419739 17:32672085-32672107 AGTGAGTGCCAGTCATGTGCTGG + Intronic
1146599832 17:34204823-34204845 ACTCAGGGCCAGGGATGGCCTGG - Intergenic
1148082047 17:44972236-44972258 AGTCAGTGCCAGTCATGCCTGGG - Intergenic
1149370748 17:55991616-55991638 AATCAGTCCCAGGTAGGTCCAGG - Intergenic
1150453248 17:65287072-65287094 GGTCAGTGACAGGAGGGTCCAGG - Intergenic
1152067438 17:78119325-78119347 TGACATTGCCCGGAATGTCCTGG - Exonic
1153146154 18:2034850-2034872 TGGCAGTGCCTAGAATGTCCCGG + Intergenic
1153658758 18:7307950-7307972 AGGCAAGGCCAGGCATGTCCCGG - Intergenic
1160096102 18:75875059-75875081 AGTCAGTGCCAGGGAAGCACTGG - Intergenic
1161408819 19:4104962-4104984 AGACAGTGCCAGGTGTCTCCTGG + Intronic
1162252320 19:9456105-9456127 GGTCTGAGCCAGGAATGCCCTGG - Intergenic
1163516392 19:17766598-17766620 AGCCAGTGCCAGCGCTGTCCCGG + Intronic
1163843602 19:19626770-19626792 AGGCAGTGCCAGGAGTGGGCAGG + Exonic
1164536661 19:29090967-29090989 AGCCAGTTCCAGGAATGCACAGG + Intergenic
1164869513 19:31631554-31631576 AGACTGTGCCCAGAATGTCCAGG - Intergenic
1165029783 19:32989479-32989501 AGGCAGTGTCAGCCATGTCCTGG - Intronic
1165162399 19:33824758-33824780 ATTCAGAGTCAGGAATGGCCGGG - Intergenic
1166266151 19:41685743-41685765 AGTCAGTGCTGGGAATGTCCAGG - Intronic
1166270601 19:41711221-41711243 GGTCAGTGCCGGGATTGTCCAGG + Intronic
1166276564 19:41758154-41758176 AGTCAGTGCTGGGATTGTCCAGG + Intronic
1166281874 19:41799574-41799596 AGTCAGTGCCAGGAATGTCCGGG + Intronic
1166406493 19:42525532-42525554 AGTCAGTGTCAGAAATGTTCAGG - Intronic
1166415445 19:42592000-42592022 AGCCAGTGCGAGGAATGTCCAGG - Intronic
1166520067 19:43474424-43474446 AGGCAGAGCCAGCATTGTCCTGG - Intergenic
925006907 2:450663-450685 ACTCAGTGACAGAACTGTCCTGG + Intergenic
925633056 2:5915189-5915211 AGTGAATGCCAAGAAAGTCCTGG - Intergenic
925886857 2:8401057-8401079 AGGCAGTCCCAGGAAAGACCTGG + Intergenic
926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG + Intergenic
926435341 2:12831867-12831889 CTTCAGTGCCAGAAATGTGCTGG + Intergenic
929306361 2:40367315-40367337 AGTCAGTGTCAGGGAATTCCAGG - Intronic
934729529 2:96647890-96647912 AGTCAGGCCCAGGAAGGCCCAGG + Intergenic
934751174 2:96795186-96795208 AGACAGTGCCTGGAAGGGCCTGG - Intronic
939900540 2:147844728-147844750 AGTCAGTTCCCAGACTGTCCGGG + Exonic
940178578 2:150906238-150906260 AGGTACTGCCAGGAATGTGCAGG - Intergenic
941080511 2:161055311-161055333 AGTCAGGGCCAGGAAGGGCAGGG + Intergenic
941935122 2:170975900-170975922 AGTCAGTGCCTGGCATGTGGTGG + Intergenic
941962983 2:171272026-171272048 TGTCAGTCCCAGGAAAGTACTGG - Intergenic
942503926 2:176621593-176621615 GGTCAGTGCCAGCAAAGTTCAGG - Intergenic
943187527 2:184631560-184631582 GGTCAGTGCCAGTGTTGTCCGGG - Intronic
943381363 2:187153057-187153079 GGTCAGTGCCAGTGATGTTCAGG + Intergenic
944642373 2:201740936-201740958 ACTCAGTGCCAGGCATTTGCGGG - Intronic
946386349 2:219386706-219386728 AGCCATTGCCAGGAACGTACTGG + Exonic
1168960101 20:1863187-1863209 AGTCAGTGCTAGGCAGGCCCTGG + Intergenic
1171180471 20:23087367-23087389 AGCCAGTGCCAGGAAACTCTGGG + Intergenic
1172131739 20:32660502-32660524 AGTCAGTGCCTGGCAGGTCATGG - Intergenic
1172762043 20:37329667-37329689 AGTCAGGGCCAATAGTGTCCAGG - Intergenic
1173005897 20:39139373-39139395 GGTGAGTGGCAGGAGTGTCCTGG + Intergenic
1173370247 20:42428651-42428673 ACTCAGTTGCAGGAATGTTCAGG + Intronic
1175705005 20:61170273-61170295 GCCCAGTGCCAGGCATGTCCAGG - Intergenic
1178121356 21:29473468-29473490 TGTCTGTGGCAGGACTGTCCTGG + Intronic
1184699692 22:46162328-46162350 GGTCAGTCCCTGGAATGTCAGGG - Intronic
949968005 3:9375597-9375619 ATACAGTGCCTGGTATGTCCTGG + Intronic
953413809 3:42704230-42704252 AGTCAGTGCCAGGAGCTTACAGG - Intronic
953853618 3:46484552-46484574 AGGCAGTGCCAAGAAGGGCCTGG + Intronic
954673630 3:52303801-52303823 AGTCAGTGCCACCATTGTGCGGG + Intergenic
956086376 3:65615398-65615420 TGTCACGGTCAGGAATGTCCAGG + Intronic
961048624 3:123727244-123727266 CCTCAGTGCCAGGCCTGTCCAGG - Intronic
963232947 3:142927241-142927263 AGTCGGAGCCAGGAATCTCAAGG - Intergenic
965815635 3:172633759-172633781 AGGCAATGCCAGGATTGTCCAGG - Exonic
965824771 3:172719425-172719447 ATTGAGTGCCAGGAATGTTGGGG - Intergenic
967315989 3:188153084-188153106 AGCCAGTTCCTGGAAGGTCCTGG - Intergenic
969709899 4:8836772-8836794 AGTCACAGACACGAATGTCCAGG - Intergenic
970515418 4:16824811-16824833 ATTGAGTGCCAGCCATGTCCTGG + Intronic
975275494 4:72495053-72495075 AACCAGTGGCAGCAATGTCCGGG + Intronic
975907731 4:79234740-79234762 TCTCAGTGCTAGGAATGTCTGGG + Intronic
977984586 4:103367094-103367116 AGTCTGGGCAAAGAATGTCCCGG + Intergenic
981775783 4:148365861-148365883 GGTCAGTGCCTGGAATTTCCGGG - Intronic
984802780 4:183730014-183730036 AGTCTGTGCAATGAATGGCCTGG - Intergenic
984930157 4:184839871-184839893 AGTCAGTAACAGGCCTGTCCTGG + Intergenic
986840389 5:11690166-11690188 AATCAGTGCCAGGAATGTGATGG + Intronic
992104578 5:73438922-73438944 ACTCAGTGCCAGAAGTTTCCAGG - Intergenic
992467017 5:77016083-77016105 TGCCAGTGCCAGGAATGCGCAGG - Intergenic
994008763 5:94875322-94875344 AGGCATTTCCAGGAATATCCAGG + Intronic
996314193 5:122142863-122142885 AGTCACTGCCAGGAACGTCATGG + Intronic
997261281 5:132467182-132467204 GGTCAGTGGGAGGACTGTCCAGG + Intronic
997955224 5:138274112-138274134 ACTGAGTGCCAGCAATGGCCTGG - Intronic
998158591 5:139800136-139800158 AGTTAGTGGCAGGATTATCCTGG - Intronic
999500273 5:152140017-152140039 ATTGTGTGCTAGGAATGTCCTGG - Intergenic
1002170725 5:177372673-177372695 GGTCAGTGCCAGGAAACTCTTGG + Intergenic
1002367152 5:178722584-178722606 AACCAGTCCCAGGGATGTCCAGG - Intronic
1003395905 6:5751740-5751762 TGTCAGTGCTTGGCATGTCCAGG - Intronic
1005398261 6:25406007-25406029 ATTTTGTGCCAGGAATGTACTGG + Intronic
1010714736 6:79215340-79215362 GGTCAGTGGCAGGAATGCCTGGG + Intronic
1010819976 6:80402672-80402694 AATCATTGCTAGGAATGTCAAGG + Intergenic
1013346517 6:109265701-109265723 AGCCAGTACCAAGAATCTCCAGG - Intergenic
1017825850 6:158081389-158081411 AGTCAATGCCAAGAACGACCTGG - Intronic
1018443545 6:163834696-163834718 AGCCCGTGCCAGGAGTGGCCAGG + Intergenic
1018519765 6:164635157-164635179 AGTCAGATCCAGGAATGCACAGG + Intergenic
1019182525 6:170199845-170199867 AGTCAGTGCCACGTCTGCCCTGG + Intergenic
1022383654 7:29883540-29883562 AGCCAGGGCCAGGACTGCCCGGG - Intronic
1026204067 7:68240170-68240192 AGGCAGTGCCAGTAAAGACCAGG - Intergenic
1026678662 7:72449004-72449026 AGTGAGTGTCAGGGGTGTCCAGG + Intergenic
1027266990 7:76499910-76499932 AGTCAGTGGCAGGCGTTTCCCGG + Intronic
1027318805 7:76999778-76999800 AGTCAGTGGCAGGCGTTTCCCGG + Intergenic
1033066417 7:138159290-138159312 AATCAGTGCAGGGAATGTCAGGG - Intergenic
1034049032 7:147962142-147962164 AGGCAGTGCCTGGAATGTAGTGG + Intronic
1034574392 7:151984853-151984875 ACACAGTGCCAGGAATGACCAGG + Intronic
1036792368 8:11729893-11729915 AGTAAGTGGTAGGAATATCCAGG - Intronic
1044934964 8:97285190-97285212 ATTCAGTGTCAGGATTCTCCTGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047213891 8:122861866-122861888 GGTCAGTGCCTGGAATGCTCAGG + Intronic
1047916073 8:129584977-129584999 AGAGAGTGGCAGGTATGTCCAGG - Intergenic
1049720421 8:144112988-144113010 TGACAGTGCCAGGAATATGCTGG - Intronic
1049992100 9:1000113-1000135 GGTCAGTGCCATGATTGGCCAGG - Intergenic
1061779583 9:132987728-132987750 ACTTACTGCCAGGAATGTCTGGG - Intronic
1062599699 9:137314347-137314369 AGTCAGTGCCGGGACTGGCCAGG - Intronic
1186099862 X:6144630-6144652 ATTCAAAGCCAGCAATGTCCAGG + Intronic
1188215040 X:27465427-27465449 AGTCAATGCCAGGAAACTGCTGG + Intergenic
1198379234 X:136068625-136068647 AGTCAGTGACAGGTAAGACCTGG - Intergenic
1201499887 Y:14630281-14630303 ACTCAAAGCCAGCAATGTCCAGG - Intronic
1201723819 Y:17133016-17133038 AGTCAGTGCCAGGTCTGCCATGG + Intergenic