ID: 1166285009

View in Genome Browser
Species Human (GRCh38)
Location 19:41820226-41820248
Sequence TTGAATAAGGATGATGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166285006_1166285009 3 Left 1166285006 19:41820200-41820222 CCAGTGCTGAAACTTCCAGTAGT No data
Right 1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG No data
1166285004_1166285009 20 Left 1166285004 19:41820183-41820205 CCTTTTCTTGCCTTATTCCAGTG No data
Right 1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG No data
1166285005_1166285009 10 Left 1166285005 19:41820193-41820215 CCTTATTCCAGTGCTGAAACTTC No data
Right 1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166285009 Original CRISPR TTGAATAAGGATGATGAGAG TGG Intergenic
No off target data available for this crispr