ID: 1166285136

View in Genome Browser
Species Human (GRCh38)
Location 19:41821136-41821158
Sequence GTTTACAGAAACCATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166285134_1166285136 5 Left 1166285134 19:41821108-41821130 CCAGAGGAGATGCTGCACCAAAG No data
Right 1166285136 19:41821136-41821158 GTTTACAGAAACCATGCTGCAGG No data
1166285133_1166285136 9 Left 1166285133 19:41821104-41821126 CCTGCCAGAGGAGATGCTGCACC No data
Right 1166285136 19:41821136-41821158 GTTTACAGAAACCATGCTGCAGG No data
1166285131_1166285136 14 Left 1166285131 19:41821099-41821121 CCATCCCTGCCAGAGGAGATGCT No data
Right 1166285136 19:41821136-41821158 GTTTACAGAAACCATGCTGCAGG No data
1166285132_1166285136 10 Left 1166285132 19:41821103-41821125 CCCTGCCAGAGGAGATGCTGCAC No data
Right 1166285136 19:41821136-41821158 GTTTACAGAAACCATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166285136 Original CRISPR GTTTACAGAAACCATGCTGC AGG Intergenic