ID: 1166288954

View in Genome Browser
Species Human (GRCh38)
Location 19:41849561-41849583
Sequence CTGCTTAGACAGATTTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166288951_1166288954 11 Left 1166288951 19:41849527-41849549 CCTAGCACAGACTCTTTAATGGT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1166288954 19:41849561-41849583 CTGCTTAGACAGATTTGATGGGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166288954 Original CRISPR CTGCTTAGACAGATTTGATG GGG Intronic
900296907 1:1956468-1956490 CTGCTTAGGCTGATTTGAGGAGG + Intronic
903654259 1:24939505-24939527 CTGTTTACACAGCTGTGATGTGG - Intronic
903898365 1:26623834-26623856 CTACATACATAGATTTGATGAGG + Intergenic
905324176 1:37138733-37138755 CTGCTGAGACAGAAGAGATGTGG + Intergenic
908918647 1:69163307-69163329 CTGCTTAGACTAATTAGATAAGG + Intergenic
910488548 1:87742837-87742859 CTGCTGAGATAGATTTCAAGAGG - Intergenic
911929237 1:103880556-103880578 CTACTTAGATACATTTGTTGTGG - Intergenic
917067223 1:171110059-171110081 ACGCTTACACAAATTTGATGAGG + Intronic
917760031 1:178146857-178146879 CTGCTGAGACCAAGTTGATGTGG - Intronic
918063016 1:181078465-181078487 CTGCTTAGTCAGTTTGGCTGCGG - Intergenic
920179285 1:204122558-204122580 ATGCCCAGACAGATATGATGAGG - Intronic
920705261 1:208245774-208245796 CAGCTTAGACAGATTCTTTGTGG - Intergenic
921778726 1:219134235-219134257 GTCCTTAGACAGATTTTCTGTGG - Intergenic
922577580 1:226672855-226672877 CTGCTAAGACAGGTGTGAAGTGG + Intronic
923993441 1:239465498-239465520 CAGTTTAGAAAGATTGGATGTGG + Intronic
1062878737 10:961675-961697 CTGCTTGTACAGAGATGATGTGG + Intergenic
1066013470 10:31215452-31215474 CAGCTTACACACATTTGATTTGG + Intergenic
1067960855 10:50847528-50847550 CTGCTTAGAATGATTTATTGAGG - Intronic
1069153675 10:64998182-64998204 CTTCTTAAACAGAGGTGATGAGG + Intergenic
1069631674 10:69901051-69901073 CAGCTGAATCAGATTTGATGTGG + Intronic
1075906723 10:126088157-126088179 CTGTGTAAGCAGATTTGATGAGG + Intronic
1080058749 11:27934508-27934530 CTGCTTGGATAGAGCTGATGGGG + Intergenic
1080111533 11:28573518-28573540 CTGTTTAGACAGAGATGAAGAGG - Intergenic
1080902259 11:36506666-36506688 CTGATTAGACAGATTTTCTTAGG - Intronic
1081386302 11:42477493-42477515 TTACTTAGACCGATTTGAGGTGG + Intergenic
1083138948 11:60705597-60705619 CTGTTTATAGAGATTTGATGGGG - Intronic
1083176901 11:60956080-60956102 CTGCTTGCACAGTCTTGATGAGG - Intergenic
1083278903 11:61613500-61613522 CTGTTTATACAGATGTGAGGTGG + Intergenic
1089237683 11:117046401-117046423 CTGCTAAAACAAATTTAATGGGG + Intronic
1090430374 11:126641197-126641219 CTACATTGACAGATTGGATGTGG - Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092110109 12:5954269-5954291 CAGCTTAGAAACTTTTGATGAGG + Intronic
1101320369 12:103668365-103668387 CTGCTTAGAGACATCTGCTGTGG + Intronic
1103419860 12:120771698-120771720 CTGCAAACACAGGTTTGATGAGG + Intronic
1103690330 12:122767824-122767846 CTGCTTGGGCACATTTTATGTGG + Intronic
1108260721 13:48653120-48653142 TTGCTTAGACAGGGTAGATGGGG + Intergenic
1110751754 13:79122972-79122994 ATGTTTAGACAAATTTGTTGGGG - Intergenic
1119379956 14:74222149-74222171 GTGCTTGGAAAGATTGGATGAGG - Intergenic
1127203727 15:56689119-56689141 ATTTTTAGACTGATTTGATGAGG + Exonic
1127356521 15:58206116-58206138 CAGATTAGACAGACTTGAGGTGG + Intronic
1127519943 15:59733905-59733927 ATGCTTAGACAAAGTTGATATGG + Intergenic
1129782686 15:78284088-78284110 CTTCCCAGACAGAATTGATGTGG + Intronic
1130006412 15:80103226-80103248 TTCCTTATACAGATTTGGTGAGG + Intronic
1137500625 16:49009054-49009076 ATGCAAAGACAAATTTGATGTGG + Intergenic
1137501472 16:49014741-49014763 GTGATTAGACAGATTGGAAGTGG + Intergenic
1137590897 16:49692765-49692787 CTGCATAGAGAGAATAGATGTGG - Intronic
1137945131 16:52726573-52726595 CTGCCTAAACAGATTTGAGTTGG + Intergenic
1143979238 17:10854030-10854052 CTGCTGAATCAGAATTGATGAGG - Intergenic
1146083693 17:29807298-29807320 CTGCTAAGACAGTTTTCATTAGG + Intronic
1152909022 17:82986605-82986627 CTGGTGAAGCAGATTTGATGCGG + Intronic
1153655241 18:7276396-7276418 CTGGGAAGACAGAATTGATGTGG - Intergenic
1155567935 18:27157988-27158010 CAGTTTAGAGAGGTTTGATGAGG - Intronic
1160578838 18:79872163-79872185 CTTCCTGCACAGATTTGATGGGG + Intronic
1164286344 19:23820978-23821000 CTGTATAGACACAGTTGATGAGG - Intronic
1166288954 19:41849561-41849583 CTGCTTAGACAGATTTGATGGGG + Intronic
928338662 2:30422156-30422178 CTGCTTAGCCAGATTGGAAATGG + Intergenic
929639627 2:43564617-43564639 CAGCTTCTAAAGATTTGATGTGG + Intronic
934914910 2:98293246-98293268 CTGCTTAGTCAGATCCCATGCGG - Intronic
937689063 2:124733848-124733870 CTGCAAAGAAAGCTTTGATGGGG + Intronic
944057959 2:195543279-195543301 CTGCTAAAACAGCATTGATGGGG + Intergenic
946115458 2:217458045-217458067 CTGCATAGACACACTTGATAAGG - Intronic
948767011 2:240227613-240227635 CTGCTCAGACAGGGCTGATGTGG + Intergenic
1169271333 20:4201684-4201706 CATCATAGACAGATTTGATTAGG + Intergenic
1175461889 20:59158084-59158106 CTGCTTAGGAAGATGTGATGTGG - Intergenic
1178532140 21:33384586-33384608 CTGTTTATAGAGAATTGATGAGG - Intergenic
1182010062 22:26993364-26993386 CTGCCTAGGCAGAGATGATGGGG - Intergenic
1184937465 22:47735605-47735627 CTGGGTAGACAGATGTGGTGAGG + Intergenic
951598411 3:24343285-24343307 GTGCTTAAACAGTTTTGATGGGG - Intronic
951890701 3:27565396-27565418 CTGCTCAGATGTATTTGATGGGG - Intergenic
952194090 3:31054291-31054313 CTGCTTACATAGAATTGATGGGG + Intergenic
952274757 3:31866466-31866488 CTCCTTAGTCAGAGTGGATGTGG + Intronic
955971168 3:64439992-64440014 CTGATTCTACAGATTTGAGGTGG - Intronic
956897342 3:73676397-73676419 CTGATTTGTCAGATTTGAAGTGG - Intergenic
961547866 3:127648055-127648077 CTGCTTTTACAGATTTCATCAGG - Intronic
961753868 3:129115080-129115102 CAGGTAAGACAGATTTGAAGAGG + Intronic
965468171 3:169058452-169058474 CTCCTTATACACCTTTGATGGGG - Intergenic
966424923 3:179771012-179771034 TTGCTTAGACAGATTTGTCTTGG - Intronic
967143331 3:186583183-186583205 CTGCTTAGACAGTTTTGCCTGGG + Intronic
967233530 3:187363838-187363860 CTGCCTAGAAAGCTGTGATGAGG + Intergenic
970115517 4:12690699-12690721 CTGGTTGGAAAGAATTGATGGGG - Intergenic
971129498 4:23790742-23790764 CAGTTTAGACAGATTTGGTTTGG + Intronic
971878354 4:32334317-32334339 CTGCTAAGGCAGAATTGATGTGG + Intergenic
974206281 4:58706690-58706712 CTGATCAGACACATTTTATGTGG + Intergenic
975969538 4:80016824-80016846 ATGCCTAGACAGATTAGGTGTGG - Intronic
976356575 4:84125744-84125766 TGGCTTAGAAAGATTTGAGGGGG - Intergenic
977903709 4:102451890-102451912 CTGCTGAGAAAGATTTGCTCAGG + Intergenic
979049690 4:115914203-115914225 CTGATTACACAGAATTGATTTGG - Intergenic
980634317 4:135479052-135479074 CTGCTCTGACAGACCTGATGTGG + Intergenic
980775934 4:137436538-137436560 CTGCTTTGACAAAGTTGATGGGG - Intergenic
982051234 4:151504501-151504523 CTGCTTAAACAGGTTTGAGTTGG - Intronic
993922617 5:93826520-93826542 GAGCTTAGACAGATTTGTAGAGG - Intronic
996345608 5:122485397-122485419 CTACTTATACTGATTAGATGAGG - Intergenic
997216528 5:132116278-132116300 CTGCTTTGAGAAATTTGCTGAGG - Intergenic
1008562990 6:52740237-52740259 CTGCTCAGACATACTTGGTGTGG + Intergenic
1008565673 6:52765925-52765947 CTGCTCAGACACACTTGGTGTGG + Intergenic
1008569861 6:52806261-52806283 CTGCTCAGACACACTTGGTGTGG + Intergenic
1008577321 6:52873712-52873734 CTGCTCAGACAGACTTGGTGTGG + Intronic
1009808823 6:68635535-68635557 CTGCTATGGCAGATTTGTTGGGG - Exonic
1013011547 6:106125260-106125282 CTGCTGAGACAGTTTTGGGGTGG + Intergenic
1014827290 6:126060974-126060996 ACTCTTAGAAAGATTTGATGGGG - Intergenic
1017878272 6:158541643-158541665 CTGCTTTGACACCTTTGATCAGG + Intronic
1020533274 7:9361512-9361534 CTGCTTAGAAAGGTGTGGTGAGG - Intergenic
1020563419 7:9761582-9761604 CTCCTTAGACAGAGATAATGAGG + Intergenic
1020565344 7:9787850-9787872 CTGCTAAGACAGTGCTGATGGGG - Intergenic
1031024950 7:116670177-116670199 CTACCTAGACAGATTTGATTGGG - Intergenic
1033470625 7:141645810-141645832 TTGCTTTGACAGATTAAATGAGG - Intronic
1038248482 8:25881398-25881420 CTCCTTAAACTGAGTTGATGGGG - Intronic
1039461013 8:37744370-37744392 CTACTTTGACAGAATTGAAGTGG + Exonic
1039577831 8:38638762-38638784 CTCATTAGCCAGATTTAATGAGG - Intergenic
1040882779 8:52225504-52225526 CTGATGGGGCAGATTTGATGAGG + Intronic
1040964485 8:53070773-53070795 CTGCTTGGTCTGTTTTGATGGGG + Intergenic
1042213644 8:66406583-66406605 CTGCTGAGGCAAATTTGATGAGG + Intergenic
1044391834 8:91661173-91661195 GTGCTGAGACAGAGTTTATGAGG - Intergenic
1044787555 8:95810491-95810513 CTAGTTTGACATATTTGATGGGG + Intergenic
1045772731 8:105762946-105762968 CTATTTAGACAAATTTGACGAGG - Intronic
1050312457 9:4367342-4367364 AGACTTAGACAGATTAGATGGGG - Intergenic
1050677694 9:8074940-8074962 CAGTTAAGATAGATTTGATGAGG + Intergenic
1052691050 9:31817440-31817462 ATGATTAGACAGATGTGGTGGGG - Intergenic
1054754539 9:68944470-68944492 CTGGTAAGACATCTTTGATGGGG - Intronic
1058321650 9:103639063-103639085 CAGCAAAGACAGAATTGATGGGG - Intergenic
1060912143 9:127359520-127359542 CTGCTTACACAGTTTTGAGAAGG - Intronic
1187130240 X:16495453-16495475 CTACTTAGGCAGCTTTGCTGTGG - Intergenic
1187230585 X:17418480-17418502 CTGTTTTGACAGATTAGATTTGG - Intronic
1187954531 X:24503758-24503780 CTGCTGATACAGTCTTGATGGGG + Intronic
1188691044 X:33129865-33129887 CTGCTTAGAAAGATTAGTTGAGG + Intronic
1190791457 X:53704477-53704499 CTGCTTAGACAGAGGAGCTGAGG + Intergenic
1196603220 X:117625443-117625465 CTGCTTTGATGGATTTGATACGG - Intergenic