ID: 1166290053

View in Genome Browser
Species Human (GRCh38)
Location 19:41857128-41857150
Sequence CCCCGCCAAAAGAAAGATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166290036_1166290053 30 Left 1166290036 19:41857075-41857097 CCAGTGCCACTGCACTCCAGAGC No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data
1166290038_1166290053 24 Left 1166290038 19:41857081-41857103 CCACTGCACTCCAGAGCAGGACC No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data
1166290040_1166290053 3 Left 1166290040 19:41857102-41857124 CCCTGTCTGCCTCCCCCTCCCCT No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data
1166290044_1166290053 -10 Left 1166290044 19:41857115-41857137 CCCCTCCCCTCCACCCCGCCAAA No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data
1166290041_1166290053 2 Left 1166290041 19:41857103-41857125 CCTGTCTGCCTCCCCCTCCCCTC No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data
1166290043_1166290053 -9 Left 1166290043 19:41857114-41857136 CCCCCTCCCCTCCACCCCGCCAA No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data
1166290042_1166290053 -6 Left 1166290042 19:41857111-41857133 CCTCCCCCTCCCCTCCACCCCGC No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data
1166290039_1166290053 14 Left 1166290039 19:41857091-41857113 CCAGAGCAGGACCCTGTCTGCCT No data
Right 1166290053 19:41857128-41857150 CCCCGCCAAAAGAAAGATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166290053 Original CRISPR CCCCGCCAAAAGAAAGATAC GGG Intergenic
No off target data available for this crispr