ID: 1166290554

View in Genome Browser
Species Human (GRCh38)
Location 19:41860546-41860568
Sequence GAGCCCGGCCCCTGCGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166290554_1166290559 11 Left 1166290554 19:41860546-41860568 CCTCACACGCAGGGGCCGGGCTC No data
Right 1166290559 19:41860580-41860602 TCCAGAGAGGCCGTGGGCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 161
1166290554_1166290558 5 Left 1166290554 19:41860546-41860568 CCTCACACGCAGGGGCCGGGCTC No data
Right 1166290558 19:41860574-41860596 GTGCGATCCAGAGAGGCCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1166290554_1166290556 -2 Left 1166290554 19:41860546-41860568 CCTCACACGCAGGGGCCGGGCTC No data
Right 1166290556 19:41860567-41860589 TCTGTTAGTGCGATCCAGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1166290554_1166290557 4 Left 1166290554 19:41860546-41860568 CCTCACACGCAGGGGCCGGGCTC No data
Right 1166290557 19:41860573-41860595 AGTGCGATCCAGAGAGGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166290554 Original CRISPR GAGCCCGGCCCCTGCGTGTG AGG (reversed) Intronic