ID: 1166290555

View in Genome Browser
Species Human (GRCh38)
Location 19:41860561-41860583
Sequence TGGATCGCACTAACAGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166290555_1166290562 18 Left 1166290555 19:41860561-41860583 CCGGGCTCTGTTAGTGCGATCCA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1166290562 19:41860602-41860624 GTGAGCTCCTTCAGACCCGCAGG 0: 1
1: 0
2: 0
3: 16
4: 111
1166290555_1166290563 24 Left 1166290555 19:41860561-41860583 CCGGGCTCTGTTAGTGCGATCCA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1166290563 19:41860608-41860630 TCCTTCAGACCCGCAGGAGCCGG 0: 1
1: 0
2: 1
3: 8
4: 154
1166290555_1166290558 -10 Left 1166290555 19:41860561-41860583 CCGGGCTCTGTTAGTGCGATCCA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1166290558 19:41860574-41860596 GTGCGATCCAGAGAGGCCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1166290555_1166290559 -4 Left 1166290555 19:41860561-41860583 CCGGGCTCTGTTAGTGCGATCCA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1166290559 19:41860580-41860602 TCCAGAGAGGCCGTGGGCGTCGG 0: 1
1: 0
2: 1
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166290555 Original CRISPR TGGATCGCACTAACAGAGCC CGG (reversed) Intronic