ID: 1166290556

View in Genome Browser
Species Human (GRCh38)
Location 19:41860567-41860589
Sequence TCTGTTAGTGCGATCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166290554_1166290556 -2 Left 1166290554 19:41860546-41860568 CCTCACACGCAGGGGCCGGGCTC No data
Right 1166290556 19:41860567-41860589 TCTGTTAGTGCGATCCAGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1166290547_1166290556 28 Left 1166290547 19:41860516-41860538 CCGGGGCTGGGGAGTGGGGTCGC No data
Right 1166290556 19:41860567-41860589 TCTGTTAGTGCGATCCAGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1166290546_1166290556 29 Left 1166290546 19:41860515-41860537 CCCGGGGCTGGGGAGTGGGGTCG No data
Right 1166290556 19:41860567-41860589 TCTGTTAGTGCGATCCAGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166290556 Original CRISPR TCTGTTAGTGCGATCCAGAG AGG Intronic