ID: 1166290557 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:41860573-41860595 |
| Sequence | AGTGCGATCCAGAGAGGCCG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 135 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 127} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166290554_1166290557 | 4 | Left | 1166290554 | 19:41860546-41860568 | CCTCACACGCAGGGGCCGGGCTC | No data | ||
| Right | 1166290557 | 19:41860573-41860595 | AGTGCGATCCAGAGAGGCCGTGG | 0: 1 1: 0 2: 0 3: 7 4: 127 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166290557 | Original CRISPR | AGTGCGATCCAGAGAGGCCG TGG | Intronic | ||