ID: 1166290557

View in Genome Browser
Species Human (GRCh38)
Location 19:41860573-41860595
Sequence AGTGCGATCCAGAGAGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166290554_1166290557 4 Left 1166290554 19:41860546-41860568 CCTCACACGCAGGGGCCGGGCTC No data
Right 1166290557 19:41860573-41860595 AGTGCGATCCAGAGAGGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166290557 Original CRISPR AGTGCGATCCAGAGAGGCCG TGG Intronic