ID: 1166290558

View in Genome Browser
Species Human (GRCh38)
Location 19:41860574-41860596
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166290555_1166290558 -10 Left 1166290555 19:41860561-41860583 CCGGGCTCTGTTAGTGCGATCCA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1166290558 19:41860574-41860596 GTGCGATCCAGAGAGGCCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 167
1166290554_1166290558 5 Left 1166290554 19:41860546-41860568 CCTCACACGCAGGGGCCGGGCTC No data
Right 1166290558 19:41860574-41860596 GTGCGATCCAGAGAGGCCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type