ID: 1166290558 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:41860574-41860596 |
| Sequence | GTGCGATCCAGAGAGGCCGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 177 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 167} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166290555_1166290558 | -10 | Left | 1166290555 | 19:41860561-41860583 | CCGGGCTCTGTTAGTGCGATCCA | 0: 1 1: 0 2: 0 3: 2 4: 43 |
||
| Right | 1166290558 | 19:41860574-41860596 | GTGCGATCCAGAGAGGCCGTGGG | 0: 1 1: 0 2: 0 3: 9 4: 167 |
||||
| 1166290554_1166290558 | 5 | Left | 1166290554 | 19:41860546-41860568 | CCTCACACGCAGGGGCCGGGCTC | No data | ||
| Right | 1166290558 | 19:41860574-41860596 | GTGCGATCCAGAGAGGCCGTGGG | 0: 1 1: 0 2: 0 3: 9 4: 167 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166290558 | Original CRISPR | GTGCGATCCAGAGAGGCCGT GGG | Intronic | ||