ID: 1166295489

View in Genome Browser
Species Human (GRCh38)
Location 19:41887475-41887497
Sequence TGGGGACTCCCAGTCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166295482_1166295489 4 Left 1166295482 19:41887448-41887470 CCTGGGGGAAAGAAGAACTTCTG No data
Right 1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG No data
1166295476_1166295489 23 Left 1166295476 19:41887429-41887451 CCTGGGAAGAGATGAGGTCCCTG No data
Right 1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG No data
1166295481_1166295489 5 Left 1166295481 19:41887447-41887469 CCCTGGGGGAAAGAAGAACTTCT No data
Right 1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166295489 Original CRISPR TGGGGACTCCCAGTCCCTGA GGG Intronic