ID: 1166295489

View in Genome Browser
Species Human (GRCh38)
Location 19:41887475-41887497
Sequence TGGGGACTCCCAGTCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166295482_1166295489 4 Left 1166295482 19:41887448-41887470 CCTGGGGGAAAGAAGAACTTCTG 0: 1
1: 0
2: 3
3: 16
4: 307
Right 1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 217
1166295476_1166295489 23 Left 1166295476 19:41887429-41887451 CCTGGGAAGAGATGAGGTCCCTG 0: 1
1: 0
2: 4
3: 21
4: 282
Right 1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 217
1166295481_1166295489 5 Left 1166295481 19:41887447-41887469 CCCTGGGGGAAAGAAGAACTTCT 0: 1
1: 0
2: 3
3: 24
4: 278
Right 1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166295489 Original CRISPR TGGGGACTCCCAGTCCCTGA GGG Intronic
900707471 1:4089637-4089659 TGGGGACTCTCAGGGCCTGGTGG + Intergenic
901486305 1:9565074-9565096 TGGTGACTGCCAGGGCCTGACGG + Intronic
901511941 1:9721898-9721920 TGGGGATTCCCAGACGCTCAGGG - Intronic
901728668 1:11262332-11262354 TGGGGACCCCACGTCCCAGACGG + Intronic
902833953 1:19034941-19034963 TGGGGACCCCCAGTCCACGGAGG + Intergenic
903761594 1:25702397-25702419 TGGGCTCTCCCAGGCTCTGAGGG + Intronic
904051977 1:27645354-27645376 TGGGGGCACCCAGGCCCTGGGGG - Intergenic
904961282 1:34335074-34335096 AGAGGACTCCCAGACCCTTAGGG - Intergenic
905979484 1:42210904-42210926 TTGGGAGTAGCAGTCCCTGAGGG - Intronic
906151822 1:43591975-43591997 GGGGGTCTCCTGGTCCCTGAGGG + Intronic
906669318 1:47643202-47643224 AGGGCTCTCCCAGTCCCTGGAGG + Intergenic
907245244 1:53104111-53104133 TTTGGGCTCCCAGTACCTGAGGG - Intronic
907310346 1:53535487-53535509 TGGGGCCTCTCAGTCCCTCATGG + Intronic
912475435 1:109931597-109931619 AGGGGCCTCCCCATCCCTGAGGG + Intergenic
912988496 1:114459148-114459170 TGGGGACTCCCAGACCCATCAGG + Intronic
915930102 1:160054989-160055011 TGGGGAGCCCCACCCCCTGATGG - Intronic
919789950 1:201284420-201284442 AGGGGAACCCCAGTCCCTGTGGG + Intronic
920100411 1:203513816-203513838 CTGGGAGTCCCCGTCCCTGAGGG - Intergenic
920113228 1:203601536-203601558 TAGGAACTCCCAGAGCCTGAGGG + Intergenic
920307623 1:205029328-205029350 TTGGGACCCGCAGTCCCTGCAGG + Intergenic
922700669 1:227758243-227758265 TGGGGACGCTGAGTCCCTGAAGG + Intronic
1065798701 10:29331378-29331400 TGGGGACTGCCATTCCCTCTGGG + Intergenic
1065819426 10:29511364-29511386 CTGGGACTCCCAGTTCCTGATGG + Intronic
1065953421 10:30673050-30673072 CTGGGACTCCCAGTTCCTGATGG - Intergenic
1066617252 10:37307906-37307928 TTAGCACTCCCAGTCCCTGCAGG + Intronic
1067054570 10:43043352-43043374 TGGGGACTCCCTGTAGCTGGAGG - Intergenic
1069591822 10:69646586-69646608 TGGGAACTCTCACTCCCAGAGGG - Intergenic
1070756788 10:78998280-78998302 TGGGGGCTCACAGGCCCTGGGGG + Intergenic
1071963070 10:90824907-90824929 TGGGGAACTCCACTCCCTGAAGG + Intronic
1075638992 10:124050777-124050799 TGGGGAGTCCCAGCCCATGAGGG + Intronic
1075868725 10:125751638-125751660 TGGGGACTCCCCGACTCTGCGGG - Intronic
1077116997 11:889699-889721 TGGGGACTGGCATTCCCTCAGGG - Intronic
1078427638 11:11264835-11264857 TGGGGACATTCAGTTCCTGATGG + Intergenic
1079324293 11:19478293-19478315 AGGGGAGTCCCAGTCACTGAGGG + Intronic
1080386013 11:31811650-31811672 TCGGGACTCCCAGTCCTCGGAGG + Intronic
1081316956 11:41641693-41641715 TGGGGCCTCCCAGACCAGGAGGG - Intergenic
1083392711 11:62366460-62366482 AGGGTTCTCCCAGTCCCTGCTGG - Intronic
1083395068 11:62385115-62385137 AGGGTTCTCCCAGTCCCTGCTGG - Intronic
1083664292 11:64266234-64266256 TGGGGACTTCTAGTACCAGAAGG + Intronic
1085518715 11:77126005-77126027 TGGGGACTCCCAGGCCCCCGCGG - Exonic
1087751402 11:102011317-102011339 GGGCCACACCCAGTCCCTGAGGG + Intergenic
1088587122 11:111369086-111369108 TGGGGATTCCAGGTACCTGAGGG - Intronic
1088918235 11:114243040-114243062 TGGGGACACTTGGTCCCTGATGG + Intronic
1088919561 11:114251241-114251263 AGGGGAGTCCCAGCCCCTCAGGG + Intergenic
1089390868 11:118100818-118100840 TGGACACTCCCTGTCCCAGAAGG + Intronic
1090893690 11:130950383-130950405 TGGAGATGCCCAGTCCCTGGTGG - Intergenic
1091433441 12:455292-455314 TGGGGAATCCTTCTCCCTGAAGG + Intergenic
1092924164 12:13258596-13258618 TGGGGAGTCCCAGAGCCTGCTGG + Intergenic
1094242299 12:28242541-28242563 TGGAGCCTCCAAGTCCCAGATGG - Intronic
1101423657 12:104569798-104569820 TGGGGACTCCCAGTGCAGCATGG - Intronic
1102455847 12:113070394-113070416 TGGGGGCACCCAGACCCTGACGG - Intronic
1104882367 12:132081388-132081410 TGGGGACACAGAGGCCCTGAAGG - Intergenic
1106026359 13:25959399-25959421 TGGGGTGTCCCAGGCCCCGATGG - Intronic
1106505342 13:30366345-30366367 AGTGAGCTCCCAGTCCCTGAAGG + Intergenic
1108154741 13:47573690-47573712 TGGGGCCTCCCAGGCCCTGCAGG + Intergenic
1108378686 13:49836906-49836928 TGGGGTCTCCCTGCCCCTCATGG + Intergenic
1108389652 13:49936044-49936066 TGGGGACCCTCTGACCCTGAAGG + Intronic
1108521589 13:51251532-51251554 AGGGGAGTCCCAGCCCCTGCAGG + Exonic
1110244368 13:73305299-73305321 TTGGGATTCCCAGCCCATGAAGG + Intergenic
1110442303 13:75538985-75539007 TGGGGACTCCCAGCTCCTAGAGG + Intronic
1114969908 14:28013186-28013208 TGAGGACTCACAGGCCCTGCAGG + Intergenic
1117766066 14:59084769-59084791 TGGAGACTTCCAATGCCTGATGG + Intergenic
1123057132 14:105575848-105575870 TGGGGACCACCAGGCCATGAGGG - Intergenic
1123081112 14:105696043-105696065 TGGGGACCACCAGGCCATGAGGG + Intergenic
1123940370 15:25213801-25213823 TGGAGACTTCAAGGCCCTGAAGG + Intergenic
1125483386 15:40095597-40095619 TGGGAACTCCCATTCTGTGAGGG - Intronic
1125715185 15:41815650-41815672 TGGGAACACCCAGGCCCTGCTGG + Exonic
1126381265 15:48049718-48049740 ATGGGACTCTCAATCCCTGAAGG - Intergenic
1129229893 15:74191277-74191299 AGGGGAAGCCCATTCCCTGAGGG + Intronic
1129854490 15:78813567-78813589 AGGGGACACCCAGTCCATGGAGG - Intronic
1130297374 15:82656785-82656807 TGGGGGCCCCCAGCCCCTGCAGG + Intergenic
1130390126 15:83447650-83447672 TTGGGACTCCTGTTCCCTGAAGG + Intronic
1131120995 15:89823427-89823449 TGGGGACGCCAAGTCCCGCATGG + Intergenic
1131321015 15:91391183-91391205 TGAGGAAACACAGTCCCTGATGG - Intergenic
1131685973 15:94767925-94767947 TGGGGAGGCACAGTCCCTGAAGG + Intergenic
1132757927 16:1494958-1494980 TGTGGACTCCCAGCCCCAGCCGG + Intronic
1135870917 16:26149646-26149668 TGGCTCTTCCCAGTCCCTGAGGG - Intergenic
1136060115 16:27720666-27720688 TGGGGACTGCAAGTAGCTGAGGG + Intronic
1137550679 16:49435411-49435433 TTGGGAGCCCCAGTCACTGAAGG - Intergenic
1137678366 16:50315934-50315956 TGGAGACTCCCTCTCCCTGGTGG + Exonic
1138559028 16:57789008-57789030 TGGTGACTCTCAGACCCTGCAGG - Intronic
1141095364 16:81159268-81159290 TGGGGGCTCCCAGTGCATGGAGG + Intergenic
1141449002 16:84084356-84084378 TGGTGACTGTCAGTCCCTGGTGG + Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1142182102 16:88676316-88676338 TGGGGACGGCCAATCCCTGTAGG + Intergenic
1143478265 17:7215159-7215181 TGGGGACTCCAACTCCCATAAGG - Intronic
1145790095 17:27621180-27621202 TGGGCACTCCCAGTCGCTGGAGG + Intronic
1145826343 17:27879903-27879925 GGGGGACTCCCTGTCTCTGGGGG - Intronic
1145901026 17:28490639-28490661 TCTGGGCACCCAGTCCCTGAAGG + Intronic
1147175603 17:38654478-38654500 TGGGGATTCCCAGTGCTTGGCGG - Intergenic
1147449621 17:40496046-40496068 TGGGAGCCCCCAGTCCCTGGGGG + Exonic
1147576580 17:41603945-41603967 TAGGCACTCCCATTCCCTGCTGG + Intergenic
1148845018 17:50524799-50524821 TGGGGGCTCCAACTTCCTGAAGG + Intronic
1151454000 17:74215334-74215356 AGGGGACTCCCTCACCCTGATGG + Intronic
1152636166 17:81431302-81431324 TGGGAACTGCCAGGGCCTGAGGG - Intronic
1153991473 18:10404278-10404300 TGGGCCCTCCCTGTCCCTGCAGG - Intergenic
1154198829 18:12285308-12285330 TGGTCTCTCCCAGTCCCGGAGGG - Intergenic
1155176757 18:23307815-23307837 TGGGGACTCAGAGTCCCAGGAGG - Intronic
1160096412 18:75877674-75877696 CTAGGACTCCCAGTCCGTGATGG - Intergenic
1160193996 18:76737942-76737964 AGGGGACCCCCAGGCCCTGGGGG + Intergenic
1161343265 19:3754075-3754097 TGGGGAGACCCAGCCCATGACGG - Exonic
1162023990 19:7883378-7883400 TGAGCACTCACAGTCCCTGTGGG + Intergenic
1162094758 19:8303794-8303816 TGGGGACACCCACTGCCTGCTGG - Intronic
1162411732 19:10510315-10510337 GGGGGACCCCAAGTCCCTGCTGG - Intergenic
1163622483 19:18369228-18369250 GGGGGACTCCCAGGACTTGAGGG + Exonic
1163646914 19:18494813-18494835 TGGGGCCTCCCAAGCTCTGAAGG - Intronic
1165247996 19:34508699-34508721 TAGGAACTTCCAGTCCCAGAAGG - Exonic
1165462237 19:35950848-35950870 AGGGGACTCCCAGAGCCAGAGGG + Intergenic
1165496021 19:36152266-36152288 CGGGGAGTCCCAGGCCCTGAAGG + Intronic
1166239216 19:41478422-41478444 TTGGGACTCCAGGTCCCTGAAGG - Intergenic
1166241862 19:41499934-41499956 TTGGGGCTCCAGGTCCCTGAAGG - Intergenic
1166295489 19:41887475-41887497 TGGGGACTCCCAGTCCCTGAGGG + Intronic
1167347499 19:48955463-48955485 TGGAGACTCACGGCCCCTGAGGG - Intronic
1167502128 19:49854341-49854363 TGGGGACTGCCTGTCCTTGCAGG + Intronic
925342990 2:3149563-3149585 TGGGCATGCCCAGTCCCTCAGGG + Intergenic
925761722 2:7191354-7191376 TGAGCACACCAAGTCCCTGAAGG + Intergenic
925887035 2:8401957-8401979 TGGGGACTCACGGACTCTGAGGG + Intergenic
926310382 2:11670362-11670384 TCGGGACTATCAGCCCCTGAAGG - Intergenic
927202398 2:20586123-20586145 TGTGGACTCACAGGCCCTCAAGG + Intronic
928325077 2:30312997-30313019 TTGGGACTCACTGTCCCTGGAGG - Intronic
930018566 2:46987102-46987124 TGGGGCCTCCCAATTCCTGATGG - Intronic
931706432 2:64950353-64950375 AGTGAATTCCCAGTCCCTGAGGG + Intergenic
937281563 2:120720858-120720880 TGAGGACACCGAGGCCCTGAGGG + Intergenic
937326147 2:120990411-120990433 TGTGGACTCCCAGCTCCTGGAGG + Exonic
938675694 2:133631754-133631776 TGGGGTCTTCCATTCTCTGAAGG + Intergenic
938812375 2:134865516-134865538 TGAGGACATCCAGTCTCTGAAGG + Intronic
940798141 2:158102491-158102513 AAGGGCCTCCCAGTGCCTGAGGG + Intronic
941857135 2:170242643-170242665 TGGGGACCCAAAGTCCCTGAAGG - Intronic
942261984 2:174174688-174174710 TGGAGACTACCAATCCATGAAGG - Intronic
944884042 2:204044362-204044384 AGGGGACTCCAAGGCCCTGGGGG + Intergenic
945416449 2:209578816-209578838 TGGGGCTTTTCAGTCCCTGAGGG - Intronic
946033384 2:216722980-216723002 TGGGCACTTCCTGTCCCTGAGGG + Intergenic
946986755 2:225282102-225282124 TGGATACTCCCATTCCCTGTGGG + Intergenic
948313181 2:237004947-237004969 TGGGGGCTCCCAGGGGCTGAAGG + Intergenic
948706000 2:239792804-239792826 TGGCCCCTCCCTGTCCCTGAGGG - Intronic
948882705 2:240868645-240868667 TGGGGGCTCCCTCTGCCTGAGGG + Exonic
1168853248 20:990764-990786 TGGAGACTCCCTGCCCCTGGAGG - Intronic
1168870539 20:1123801-1123823 TGGGAACCTCCAGTCCCTGCTGG - Intronic
1169266113 20:4168169-4168191 TGGAGACTTCTGGTCCCTGAGGG - Intronic
1170494832 20:16914824-16914846 TGGGGGCTCCAAGTCCTTGCTGG - Intergenic
1172663617 20:36584213-36584235 AGGAGGCTCCCAGTCCCTAAAGG + Intronic
1175213766 20:57378582-57378604 TGGGGACTCCCTTTCCCCTAAGG - Exonic
1175949465 20:62575543-62575565 TGGGGAGACCCAGTCCCACACGG + Intergenic
1178673360 21:34611910-34611932 AAGGGAGTCCCAGTCTCTGAGGG - Intronic
1180847867 22:18994271-18994293 TGGGGACTCCCAGGCCATCCTGG - Intergenic
1181568434 22:23753274-23753296 TGGAGACTCCCAGTCCCAAAGGG + Intronic
1182094831 22:27619114-27619136 TGGGGCCTCCCAGAACCTGCTGG + Intergenic
1182475393 22:30574188-30574210 CAGGGCTTCCCAGTCCCTGAAGG - Intronic
1182476650 22:30580178-30580200 TGGGCTCTCCCTGTCCCTGTAGG - Exonic
1183301850 22:37062567-37062589 TGGGAACCCCAAGTCCCTGGAGG - Exonic
1183415093 22:37677213-37677235 TGGGGGCGCCCAGACCCTGCGGG - Intronic
1184683651 22:46086186-46086208 TGGAGACTCCCAGCACCTGGTGG + Intronic
1184931366 22:47683578-47683600 CCCCGACTCCCAGTCCCTGAGGG + Intergenic
949549290 3:5098949-5098971 TGGGGACTACCAGTCAGGGAGGG - Intergenic
949898878 3:8793415-8793437 TGGGGGATCCCAGTCACTGATGG - Intronic
953000854 3:38931700-38931722 TGGGGACTCCCAGACCTTGCAGG - Intronic
953272948 3:41463549-41463571 TGAGGACTCCCTGGCACTGAAGG + Intronic
955750885 3:62184627-62184649 TGGGGACTGCCTGGCCCTGGTGG - Intronic
958115437 3:89210357-89210379 CATGGACTCCCAGTCCCTGGTGG + Exonic
961116487 3:124334318-124334340 TGGGAACTCCGAATCCCTCACGG + Exonic
961203111 3:125059914-125059936 TGGTGACTACGGGTCCCTGAGGG + Intergenic
965091138 3:164163643-164163665 AGGGGAGTCCCAGTCCCTCATGG + Intergenic
968191400 3:196670427-196670449 TGGGGCCTCCCAGTCATTGAGGG + Intronic
968830463 4:2930968-2930990 TGGCGTCACCCAGTCCCCGAGGG + Intronic
969299853 4:6291455-6291477 TGGGAAGACCCAGCCCCTGAGGG - Intronic
973974891 4:56253182-56253204 TGGCCTCTCCCAGGCCCTGAAGG + Intronic
976072446 4:81257446-81257468 TGGGGGCTCCCAGACCCAAAGGG + Intergenic
978828661 4:113055302-113055324 TGGGGACACCCAACCCCCGAGGG + Intronic
981125387 4:141100127-141100149 TGGGAACTCCTAGTCCCTTGAGG - Intronic
982271259 4:153591530-153591552 AGGGGAGCCTCAGTCCCTGATGG - Intronic
982680280 4:158419715-158419737 GGGGGTCTCCCAGGTCCTGAAGG + Intronic
985769660 5:1801045-1801067 TGGGTACTCCTAATCGCTGAAGG + Intronic
989591558 5:43117815-43117837 TTGGGACTCCTAGTCCCAAATGG - Intronic
998325854 5:141279327-141279349 TTAGAAGTCCCAGTCCCTGAAGG + Intergenic
1001224801 5:169934422-169934444 TGGGGACACCCTGCCCTTGAGGG - Intronic
1001601885 5:172934349-172934371 TGGGGAAGCCAAGTCCCTGAGGG + Intronic
1002092683 5:176814226-176814248 CGGTGACTCCCAGTGCCTGCAGG + Intronic
1003566218 6:7224742-7224764 TGAGGACTTCCAGCCCCTAAAGG + Intronic
1004021370 6:11778865-11778887 TTGGAACTCTCAGTCCCAGAGGG - Intronic
1006434722 6:34020212-34020234 AGGGGACTGGTAGTCCCTGAGGG + Intronic
1006784809 6:36659132-36659154 TGGGGACTGCAAGTCCAAGATGG - Intergenic
1008486631 6:52043066-52043088 TGGTGACTCCCAGTTCTTGCAGG - Exonic
1011839428 6:91478123-91478145 TAGGGTATCCCATTCCCTGATGG - Intergenic
1011893429 6:92194748-92194770 TGGGGTCTCCCAGGTCCTGCAGG + Intergenic
1012372974 6:98529706-98529728 AGTGCACACCCAGTCCCTGAGGG + Intergenic
1012382839 6:98640802-98640824 TTCTGACTCTCAGTCCCTGATGG - Intergenic
1015210963 6:130697878-130697900 TGGGAACTCACAGTACATGAGGG + Intergenic
1015699776 6:136023104-136023126 TGGGGTCTCACAGTGCCTGATGG - Intronic
1016160562 6:140874209-140874231 TGGGTCCTCCCAGAACCTGAGGG - Intergenic
1016448217 6:144154436-144154458 TGGAGACTCACAGTGTCTGAAGG + Intronic
1017501401 6:155026591-155026613 TGGGGACTGGCAGTCCTTGAGGG + Intronic
1018223947 6:161609785-161609807 TGGGGAGTCGCAGTGCCTGGGGG + Intronic
1018658311 6:166061790-166061812 TGGGAACTTCAAGTTCCTGAAGG + Intergenic
1018746963 6:166769782-166769804 TGGGGCCTGCAAGTCCCTGATGG - Intronic
1018852171 6:167648613-167648635 GGGTGTCTCCCAGGCCCTGAAGG - Intergenic
1018945917 6:168346521-168346543 TGGGGACCCCCCTTCCCTGGGGG - Intergenic
1019296896 7:282387-282409 TGGGGACTCCCAGAGCGGGAAGG + Intergenic
1019296911 7:282437-282459 TGGGGACTCCCAGAGCGGGAAGG + Intergenic
1020641061 7:10754234-10754256 TGGGGCCTCCCAGTGGATGAGGG + Intergenic
1021478646 7:21091386-21091408 TGAGGACACCCAGCCTCTGATGG - Intergenic
1021842049 7:24728713-24728735 TGGGGACTGCTAGTACCTGCGGG - Intronic
1023904737 7:44513981-44514003 TGGGGACTCCCTGACCCTCTTGG - Intronic
1024341750 7:48271353-48271375 TGGGCACTCCCAGTCCTGGAAGG - Intronic
1024357339 7:48427525-48427547 TGTGAACTCCCAGACCCTCACGG - Intronic
1026878148 7:73891519-73891541 AGGGGACTCCCAGTCTGGGATGG + Intergenic
1027176284 7:75905899-75905921 TGGAGACTCCCAGCCCCTGGAGG + Intronic
1030678524 7:112409510-112409532 TGGGGTCTCCTCGTCCCTGCCGG + Intergenic
1033240303 7:139673544-139673566 TGAGGACTCCCAGGGGCTGAGGG + Intronic
1033413922 7:141145762-141145784 TGGCCACCCCCAGCCCCTGAAGG - Intronic
1034202696 7:149292511-149292533 TGAGGTCGCCCAGTCCTTGAAGG + Intronic
1034852534 7:154508354-154508376 GAGGGAACCCCAGTCCCTGAAGG - Intronic
1035076439 7:156180718-156180740 TGGGGACTGACAGTCCCCAAAGG + Intergenic
1035183142 7:157105356-157105378 TGGGGACTCCAGGTCACAGATGG + Intergenic
1036215624 8:6877600-6877622 TGGCGGCTCACAGACCCTGAAGG + Intronic
1037507647 8:19547872-19547894 TGGCCACTGCCAGACCCTGAGGG + Intronic
1040042834 8:42933840-42933862 TGTGGACTCCCACTCCCTGTTGG + Intronic
1040882599 8:52223133-52223155 TAGGGACTCTCAGTCCTTTATGG + Intronic
1045295552 8:100869200-100869222 TGGGGAAGCCAAGTCCTTGAGGG + Intergenic
1049286392 8:141777647-141777669 TGGGGCCTCCCAATCCCCCAAGG - Intergenic
1049801214 8:144518213-144518235 CGGGGACTCCCAGTCCTTCCCGG - Intronic
1053042242 9:34884742-34884764 CAGGGACTCCCAGTCCCTGGAGG + Intergenic
1056579572 9:87880980-87881002 TGGGGGTTCCCAGTCTCTGGTGG - Intergenic
1056676638 9:88681865-88681887 TGGGGATGCCCAGTGCCTGCTGG + Intergenic
1056935433 9:90912266-90912288 TGGGTTCTCCCAGAGCCTGAGGG + Intergenic
1060220000 9:121759407-121759429 TGGGGGCTCCCAGGACCTAATGG - Intronic
1061294265 9:129668225-129668247 TGTGGACTCCCAAGTCCTGAAGG + Intronic
1061536992 9:131256550-131256572 TGGGGCCTCCCTGTCCCCGTGGG + Intergenic
1062243613 9:135552424-135552446 TGGGGCCTGCCAGTCCCAGGTGG + Intergenic
1062528919 9:136991314-136991336 TGGGATCTCCCTGTCCCTGGTGG + Intergenic
1203787449 EBV:135862-135884 TGGGGACTTCCTGTCCCTGCTGG + Intergenic
1203445800 Un_GL000219v1:54928-54950 TTAGGACTTCCAGTCCCTGCTGG - Intergenic
1185927533 X:4163917-4163939 TGGGGACTACCAGAGGCTGAAGG + Intergenic
1186841160 X:13485951-13485973 TGGGGAGTCTCAATCCATGAAGG + Intergenic
1187206448 X:17186213-17186235 TAGGGACACACAGTCCCTGAAGG + Intergenic
1190003330 X:46710503-46710525 TGGGGATTCCCAGGCTCTTAAGG - Intronic
1190421582 X:50290143-50290165 TGGCCCCTCCAAGTCCCTGATGG + Intronic
1190878114 X:54474333-54474355 TTAGGTCTCCCAGTCCCGGAGGG + Intronic
1191692210 X:63952311-63952333 TGGTGTCTCCCAGGCCCTGCAGG - Intergenic
1194783827 X:98057815-98057837 AGGGGAGCCCAAGTCCCTGAAGG - Intergenic
1198346817 X:135767673-135767695 TGGGGGCTCCCTGTCGGTGATGG - Intronic
1198348724 X:135784957-135784979 TGGGGGCTCCCTGTCGGTGATGG - Intergenic
1198350629 X:135802231-135802253 TGGGGGCTCCCTGTCGGTGATGG - Intronic
1198352536 X:135819494-135819516 TGGGGGCTCCCTGTCGGTGATGG - Intronic
1198354445 X:135836762-135836784 TGGGGGCTCCCTGTCGGTGATGG - Intronic
1198356355 X:135854020-135854042 TGGGGGCTCCCTGTCGGTGATGG - Intronic
1198358268 X:135871294-135871316 TGGGGGCTCCCTGTCGGTGATGG - Intergenic
1198360182 X:135888568-135888590 TGGGGGCTCCCTGTCGGTGATGG - Intronic
1198851907 X:140974074-140974096 AGGGGACTTCCAATGCCTGATGG - Intergenic
1199863376 X:151821750-151821772 TGGGGACCCCAAGGCCCTGAGGG + Intergenic