ID: 1166302239

View in Genome Browser
Species Human (GRCh38)
Location 19:41917878-41917900
Sequence TCGTGCACCCAGATGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166302239_1166302243 -7 Left 1166302239 19:41917878-41917900 CCCTGTCCCATCTGGGTGCACGA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1166302243 19:41917894-41917916 TGCACGAAGCCAGCTCCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166302239 Original CRISPR TCGTGCACCCAGATGGGACA GGG (reversed) Intronic
900598696 1:3493935-3493957 TCCTGCACCCAGACGGGACGGGG + Intronic
903761557 1:25702211-25702233 TTGAGCACCCAGATGGACCAGGG + Intronic
907977049 1:59441852-59441874 TCCTGCCCCCAGATGTGAAATGG - Intronic
908560518 1:65301651-65301673 TGGTGCACCCAGAGAGGGCATGG - Intronic
913049076 1:115099809-115099831 TCGTGCAGCCAGTTGGGGGAAGG + Intergenic
920078550 1:203354982-203355004 TTGTGTGCCCAGCTGGGACAGGG - Intergenic
920381075 1:205534874-205534896 TCTTGCACCCCGGTGGGACCTGG + Intergenic
924777343 1:247119334-247119356 TCATGCACCCAGCTGGGTCCTGG + Intergenic
1067204234 10:44199805-44199827 TGGTGCAGCCACATGGGACCTGG + Intergenic
1069735350 10:70650351-70650373 TGGAGCACCCAGCTGGGACTGGG - Intergenic
1071431869 10:85612885-85612907 GGGTGCACCCAGGAGGGACAGGG + Intronic
1078516341 11:12025970-12025992 TGGTGCACCTGGATGGCACATGG - Intergenic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1085363677 11:75917003-75917025 TCATGCACCCAGAGGTCACAAGG - Intronic
1087924717 11:103906462-103906484 GTGTCCACCCAGATGGGAAAAGG + Intergenic
1091998604 12:5015309-5015331 CCTTTCACCTAGATGGGACAAGG - Intergenic
1092302877 12:7269061-7269083 TCTTGGACTCAGATCGGACAAGG + Intergenic
1098132180 12:67362267-67362289 TGGTGCACCCAGAGAGAACATGG + Intergenic
1100040340 12:90309919-90309941 TGGTGCACCCAGAGAGGGCATGG - Intergenic
1103121297 12:118381813-118381835 GCGTACACCCAGATGGAAAACGG + Intronic
1106126566 13:26904510-26904532 TCCTTAACCCCGATGGGACAGGG - Intergenic
1107240521 13:38228750-38228772 TGGTGCACCCAGAAAGGGCATGG + Intergenic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1117969886 14:61241246-61241268 TGGTGCACCCAGAGAGGACATGG - Intronic
1120859595 14:89243009-89243031 TCCTGCCCCCTGATGGGAGACGG + Intronic
1121776780 14:96596524-96596546 TCATGCACCCAGATGTGTGAGGG - Intergenic
1129292768 15:74581083-74581105 TGGTGTGCCCAGATGGGGCAGGG - Intronic
1129759975 15:78123668-78123690 TCGTTCACCCTGTTGGGACTGGG - Intronic
1131455002 15:92576697-92576719 TCGTGCACCCAGCTGAGAGGTGG - Intergenic
1133077091 16:3288480-3288502 CCAGGCACCCAGGTGGGACAAGG + Exonic
1135072284 16:19362605-19362627 TGGTGCACCCAGAGAGGGCATGG - Intergenic
1139583085 16:67884752-67884774 TCCAACACCCAGATGGGAAAAGG - Intergenic
1140476559 16:75242084-75242106 ACGTAAACCCAGATGGCACAGGG + Intronic
1141673933 16:85507627-85507649 ACCTGCACCCAGAGGGAACACGG - Intergenic
1143618296 17:8066568-8066590 TCGTGCACCCAGCGGCAACAAGG - Intergenic
1144263674 17:13547553-13547575 CTGTGCACCCAGAGAGGACATGG + Intronic
1146006334 17:29162990-29163012 TCCTGCACACAGATGGGGCCAGG - Intronic
1146487987 17:33259705-33259727 TCATGCACCCAGCTGGGAATAGG + Intronic
1148552209 17:48557306-48557328 TGGTGCATCCAGATGGGAGAAGG - Intronic
1152898665 17:82927891-82927913 TTGCGGACCCTGATGGGACAAGG - Exonic
1153028898 18:695098-695120 ACGTGATCCCAGATGGGATATGG - Intronic
1153094301 18:1383323-1383345 ACTTGCACCCTGATGGGGCAAGG - Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1166302239 19:41917878-41917900 TCGTGCACCCAGATGGGACAGGG - Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
1168475016 19:56669276-56669298 TCGAGCACCCAGAGAGGGCATGG - Intronic
928854520 2:35788591-35788613 TGGAGCACCCAGGTGGGACTGGG - Intergenic
929667589 2:43845251-43845273 CCAGGGACCCAGATGGGACATGG + Intronic
930017482 2:46980970-46980992 TGGTGCACCCAGAGGGGCCCTGG - Intronic
931059081 2:58505978-58506000 TTTTACACCCAGATGGGACCAGG + Intergenic
1169789941 20:9399282-9399304 TCATCCACCTAGATGGCACAAGG + Intronic
1173042404 20:39476784-39476806 TGGTGCACCTGGAGGGGACATGG - Intergenic
1173842619 20:46168045-46168067 CCATGCACCCAGAGGGAACATGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1183036344 22:35143736-35143758 TGGTGCGCCCTGCTGGGACATGG + Intergenic
1185322758 22:50209457-50209479 TCGCCCACCCACATGGAACATGG - Intronic
949401203 3:3666714-3666736 TCCTGCACCCTGATGGGTGAGGG + Intergenic
950662514 3:14475318-14475340 CACTGCACCCAGCTGGGACATGG + Intronic
958164570 3:89862995-89863017 CGGTGCACCCAGAGAGGACATGG + Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
975202701 4:71609904-71609926 TGGTGTGCCCAGATGGGGCATGG + Intergenic
981643554 4:146972915-146972937 TGGTGCACCCAGAGAGGGCATGG - Intergenic
986866991 5:12000961-12000983 TCTTGAAACCAGCTGGGACAGGG + Intergenic
987203060 5:15596829-15596851 TGGTGCACCCAGAGAGGGCATGG + Intronic
988694566 5:33608072-33608094 TGGAGCACCCAGAGGGGGCATGG + Intronic
994787857 5:104187160-104187182 TGGAGCACCCAGGTGGGACTGGG - Intergenic
994874381 5:105397602-105397624 TCGTGCATCCAGATGGACTAAGG + Intergenic
995175252 5:109168561-109168583 TGGTGCACCCAGAGAGGGCATGG + Intronic
1003324429 6:5081974-5081996 TGGTGCACCCAGAGGGGCCCTGG + Intergenic
1006897421 6:37479959-37479981 GACTGCACCCAGATGGCACAGGG - Intronic
1007338157 6:41170289-41170311 TGGTGCACCCAGAAAGGACATGG - Intergenic
1007811858 6:44491916-44491938 TGGTGCACCCAGAGAGGGCATGG + Intergenic
1014806808 6:125838967-125838989 TGGTGCACCCAGAGAGGGCATGG - Intronic
1018994584 6:168701314-168701336 TGGTGCTGCCAGATGGAACAGGG - Intergenic
1019177196 6:170165962-170165984 TCTTACACCCAGATAGGACCTGG + Intergenic
1026321686 7:69273980-69274002 CAGTGCACCCATATGGGTCATGG - Intergenic
1029133957 7:98355209-98355231 TCCTGCAGCCAGAAGGGACCAGG - Intronic
1029195397 7:98802116-98802138 GCCTGCAGCCAGAGGGGACAGGG - Intergenic
1034276591 7:149826518-149826540 TCCTGCACACAGATGGCACCAGG - Intergenic
1035068180 7:156122912-156122934 GCGTGCACTCAGGTGGGCCACGG + Intergenic
1036156540 8:6347413-6347435 TTGAGAACCCAGATGGCACAGGG - Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1039846193 8:41327224-41327246 TCATACAGCCAGATGAGACAAGG + Intergenic
1042929348 8:73997880-73997902 TGGTGCACCCAGAGAGGACATGG - Intronic
1043269909 8:78319314-78319336 TCTTGGCCCCACATGGGACATGG - Intergenic
1044065918 8:87700139-87700161 TCATGCACCCACATGGGCAAAGG - Intergenic
1199760198 X:150898945-150898967 TCGAGGACCGAGGTGGGACAGGG - Intergenic