ID: 1166303472

View in Genome Browser
Species Human (GRCh38)
Location 19:41924828-41924850
Sequence CGGTGTTTCTGGAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166303464_1166303472 22 Left 1166303464 19:41924783-41924805 CCTCGAGGAGAGAGCTGGTCAGA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166303472 Original CRISPR CGGTGTTTCTGGAGAGAAGC AGG Intronic
900149029 1:1170263-1170285 CGGTGCTTATGGAGAGGAGGAGG - Intergenic
900936391 1:5768864-5768886 CATTGTTTCTGGAGAGGACCAGG - Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901526745 1:9827879-9827901 GGGTGTTTGTGGAGCGGAGCCGG + Intergenic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
902819137 1:18932939-18932961 GGGTGTTTCTGGAGACACCCAGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
906885937 1:49648664-49648686 CATAGTTTCTGGAGAGAAGTTGG - Intronic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
916632958 1:166636924-166636946 CACTGTTACTGGAAAGAAGCAGG - Intergenic
916683827 1:167127011-167127033 TGGAGCTGCTGGAGAGAAGCCGG + Exonic
917591329 1:176480084-176480106 AGCTGCTGCTGGAGAGAAGCCGG + Intronic
918121891 1:181547504-181547526 CGGGGACTCTGGAAAGAAGCTGG - Intronic
919062526 1:192651726-192651748 GGTTATTTCTGGAGAGAAGACGG + Intronic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG + Intronic
924060986 1:240174050-240174072 GGGAGTTGGTGGAGAGAAGCAGG - Intronic
924465932 1:244299263-244299285 TTGTGTCTCTGCAGAGAAGCAGG - Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065037892 10:21659343-21659365 TGGTCATTCTGGAGAGAAGAAGG - Intronic
1067829998 10:49606130-49606152 CTGTATTTCTGTGGAGAAGCAGG - Intergenic
1068618952 10:59156378-59156400 CGGAGTTTTGGGAGAGAAACTGG - Intergenic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1070854178 10:79593472-79593494 CAGTGTTACAGGAGAGAAGTGGG + Intergenic
1074145096 10:110710610-110710632 CAGTTTTCTTGGAGAGAAGCTGG + Intronic
1074394419 10:113085831-113085853 CAGTGTTTCTGGAGAAAGCCAGG + Intronic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075429285 10:122366864-122366886 TGATTTTTCTGGAGAGAGGCTGG + Intergenic
1075454760 10:122577918-122577940 CAGAGTATCTGCAGAGAAGCAGG - Intronic
1076756873 10:132577155-132577177 CGCTGCACCTGGAGAGAAGCTGG + Intronic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1077849522 11:6062099-6062121 GGGTGTTCCTGGAGATGAGCAGG - Intergenic
1080737448 11:35030715-35030737 CTGTGTTCCTGGCGAGAGGCTGG + Intergenic
1086111179 11:83200098-83200120 GGGTGATTTTGGAGAGAAGGGGG + Intronic
1087045852 11:93843283-93843305 GTGTGTTGCTGGAGAGAAACAGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1089254930 11:117189154-117189176 AGGTATTGCTGGGGAGAAGCTGG - Exonic
1090400022 11:126443129-126443151 TGGCGTTTCTGGGGAAAAGCAGG - Intronic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1091416488 12:291395-291417 AGGTGTTAGTGGAGAGAACCTGG + Intronic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1095953598 12:47794764-47794786 GGGTGCTGCTGGAGAGGAGCGGG + Exonic
1096599785 12:52721364-52721386 AGGGGTTTCTGCAGAGGAGCTGG - Intergenic
1097966531 12:65587364-65587386 CGGTCATTATGGAGGGAAGCAGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1101553837 12:105788330-105788352 CGGTGTTTCTGGGAAGAGTCTGG - Intergenic
1102269874 12:111524034-111524056 GAGTCTTTCTGGAGAGAATCTGG - Intronic
1104474946 12:129063592-129063614 TGGTGGGTCTGCAGAGAAGCTGG - Intergenic
1104512518 12:129393427-129393449 CTGTGATTCTGGAAAGAAACAGG - Intronic
1105409810 13:20161690-20161712 AAGTGTGTCTGAAGAGAAGCAGG - Intergenic
1106316882 13:28602113-28602135 GGGGGCTTCTGGAGTGAAGCGGG + Intergenic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1113486389 13:110655599-110655621 CGCTGCTTCAGGAGAGAAGCCGG + Intronic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1119753740 14:77098906-77098928 TAGTGTTTCTGGGGAGAAGGTGG + Intronic
1122718674 14:103709988-103710010 CGCTGTCTGTGGCGAGAAGCCGG - Intronic
1122809989 14:104283118-104283140 TGGCCTTTCTGGAGAGGAGCTGG - Intergenic
1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG + Intergenic
1128133940 15:65249097-65249119 CCATGTTTTTGCAGAGAAGCAGG - Intronic
1129009576 15:72403037-72403059 TGGTGTTGCTGGAGACAAGCTGG - Intronic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1131225133 15:90618331-90618353 CAGTAATTCTGGACAGAAGCTGG - Intronic
1131266562 15:90918858-90918880 AGGGCTTTCTGGAGAGAAGGGGG + Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1134560460 16:15204776-15204798 TGGTGTCCCTGGAGAGCAGCTGG - Intergenic
1134920999 16:18116390-18116412 TGGTGTCCCTGGAGAGCAGCTGG - Intergenic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1138605750 16:58087054-58087076 CGTGGATGCTGGAGAGAAGCAGG - Intergenic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143906767 17:10215496-10215518 CAGTAATTCTGGAGAGCAGCTGG - Intergenic
1146367796 17:32242813-32242835 CTGTGTTACTGGAGAGCAACAGG + Intronic
1148989985 17:51657472-51657494 AGGTGGGTCTGGAGAAAAGCAGG + Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1151734585 17:75931179-75931201 CAGTGTTTCTGGGGATAAGTAGG + Intronic
1152193805 17:78904380-78904402 TGTTGTTTCTTGAGAGAAGAAGG + Intronic
1153542905 18:6175230-6175252 CACTGTTTCTGGTGAGAAGGTGG - Intronic
1154100019 18:11464376-11464398 CAGTATTGCTGGACAGAAGCGGG + Intergenic
1155208208 18:23578701-23578723 AAGTGCTGCTGGAGAGAAGCTGG - Intronic
1157102586 18:44743980-44744002 TGGAGTTTCTGGAGAGATTCTGG + Intronic
1157689273 18:49667873-49667895 TGATGTGTCGGGAGAGAAGCAGG + Intergenic
1158849641 18:61482525-61482547 TAGTGTTTCTGGAGAGAAGGTGG - Intronic
1160129131 18:76208794-76208816 GGGTGTCTCTGGAGAGGGGCCGG + Intergenic
1161528213 19:4770531-4770553 CGGTTCTCCTGGAGAGAAGCAGG - Intergenic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1165426787 19:35750255-35750277 CGGGGGTTCAGGAGAGAGGCTGG + Intronic
1166301717 19:41915027-41915049 CGGGGCTGCTGGAGAGACGCGGG - Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
926624565 2:15080393-15080415 CAATGTTTCTGGAGAGATACAGG - Intergenic
926707603 2:15847593-15847615 CGGGGTTTCTGTAGTGAAGATGG + Intergenic
929266969 2:39929135-39929157 CTGTGCTTCTGGGGAAAAGCGGG - Intergenic
929671640 2:43880516-43880538 CGATGTTTCTCCAGAGAATCTGG + Intergenic
929714164 2:44293624-44293646 AGGTGTTTGGTGAGAGAAGCAGG + Intronic
930519230 2:52442794-52442816 TGATGTTTCTCCAGAGAAGCTGG + Intergenic
931057946 2:58493879-58493901 TGATGTTTCTTGAGAGAAGAGGG + Intergenic
936942264 2:117897303-117897325 TATTGTTTCTGAAGAGAAGCTGG + Intergenic
937895178 2:126972439-126972461 AGGGGCTTCTGGAGAGGAGCTGG + Intergenic
938726513 2:134113424-134113446 CAGTCTTGCTGGAGAGAGGCTGG + Intergenic
939096478 2:137838575-137838597 CGCTGTTTCAGGAGAAAAGGAGG - Intergenic
939169236 2:138674722-138674744 CCCTCTTTCTGGAGAGATGCTGG - Intronic
939960474 2:148561231-148561253 CGGGTTTGCTGGAGAGATGCCGG - Intergenic
945762281 2:213928441-213928463 TGAAGTTTCTGGAGAGAAGGTGG - Intronic
946113324 2:217439077-217439099 CAGAGTTACTGGAGAGAAGTAGG - Intronic
946829097 2:223709452-223709474 CAGTGTTTCTGATGAGAAGTCGG - Intergenic
947040253 2:225910419-225910441 CTGTATCTCTGGGGAGAAGCAGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948344572 2:237284635-237284657 TGGTGCCTCAGGAGAGAAGCAGG - Intergenic
949061397 2:241960020-241960042 TGGTGTTTGTGGAGAAAAGCTGG - Intergenic
1169509522 20:6248799-6248821 CATGGTTTCTGAAGAGAAGCTGG + Intergenic
1170524977 20:17227992-17228014 CGTTGTTCCCGGAGAGGAGCAGG - Intronic
1171096817 20:22340151-22340173 CGGCCTTGCTGGAGAGATGCTGG - Intergenic
1172937331 20:38629583-38629605 CGGTGCTCCTGCAGAGGAGCAGG + Exonic
1174184661 20:48698101-48698123 ATGTGTCTCTTGAGAGAAGCTGG - Intronic
1175138393 20:56842074-56842096 AGCTGTTTCTGCAGAGAAGCTGG + Intergenic
1178025176 21:28458021-28458043 CGATGTTTCTGGAGAGTCCCTGG + Intergenic
1178028236 21:28492802-28492824 TGGAGTTTCTGGAGACAAACTGG - Intergenic
1178944361 21:36933922-36933944 CGGAGTTCCTGGAGACAAGGGGG + Intronic
1180222685 21:46369378-46369400 AGGTGCCTCTTGAGAGAAGCTGG + Intronic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1182288259 22:29260448-29260470 CGGAGTCCCTGGGGAGAAGCTGG + Exonic
1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG + Intronic
1184731652 22:46373994-46374016 CGTTGTTTCTGGAGGGTGGCTGG - Intronic
949766831 3:7535993-7536015 AGATGTTTCAGGAGAGAAACTGG + Intronic
950168345 3:10817877-10817899 CGCTGTATCTGCAGAGAGGCAGG - Intronic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
950880198 3:16317064-16317086 CTGTGTTTCAGGACAGCAGCAGG - Exonic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
953268773 3:41419245-41419267 CGGTGTTTCTGAGGACCAGCAGG + Intronic
953308037 3:41848528-41848550 AGGTGTTTCTGAAGAGAGCCTGG - Intronic
958874152 3:99596524-99596546 AGGCGTTTCTGGGGACAAGCAGG + Intergenic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
962376527 3:134863000-134863022 AGGGCTTCCTGGAGAGAAGCTGG + Intronic
963396144 3:144737263-144737285 CTGTGTTTCAGAAAAGAAGCAGG + Intergenic
964393071 3:156217746-156217768 TGGTGTCTCTGGAAACAAGCTGG + Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967814593 3:193788241-193788263 CTGTGTTGCTGGGGAGAAGGTGG + Intergenic
970785983 4:19796861-19796883 TGGTGTTTCTGAGGAGAAGGAGG + Intergenic
971969270 4:33600855-33600877 CGGTGTGACTGTAGAGAAGGAGG - Intergenic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
972511415 4:39771167-39771189 CCGTGTAGCAGGAGAGAAGCAGG + Intronic
976167146 4:82268238-82268260 TGGGGTTTCTGGAGAGAGGAAGG - Intergenic
977233906 4:94484033-94484055 CCTTGTTTCTGGAGACATGCAGG - Intronic
978300768 4:107267488-107267510 TGGTGTTTCTGGAAAACAGCGGG - Intronic
980062471 4:128146618-128146640 TGGTTTTTCTGGAGAGAAGGAGG + Intronic
980988381 4:139717604-139717626 AGGTGTTTTTGGAGAGGAGGCGG - Exonic
984704902 4:182840470-182840492 GGGTGATTCTGGTGAGAAGCTGG - Intergenic
985355421 4:189114381-189114403 CGGTGCTTCTGCACAGGAGCCGG + Intergenic
988008779 5:25455189-25455211 CAGTGCTTCTGGATAGAAGATGG - Intergenic
993204372 5:84861414-84861436 CTGTGTTTCTGGATAGCAGAAGG - Intergenic
993586313 5:89734091-89734113 CAGTATTTCTGGAGAGTTGCTGG - Intergenic
994408046 5:99370634-99370656 CAGTGGTTCAGGAGAGAACCTGG - Intergenic
999661916 5:153873650-153873672 CTGTGATTCTGGAGAGATTCTGG + Intergenic
1003034870 6:2633625-2633647 GGTTGCTTCTTGAGAGAAGCCGG - Exonic
1003116708 6:3288265-3288287 GGGTGTTTGGGGAGAGAAGGGGG - Intronic
1003570562 6:7253815-7253837 CTGTGTTGCTGGGGACAAGCTGG + Intergenic
1003722435 6:8718678-8718700 CAGTATTTCTGGAGAAAAGAAGG - Intergenic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1007671794 6:43561033-43561055 CGGTGTTGATCGAGAAAAGCAGG + Intronic
1007679381 6:43624022-43624044 CAGTGTGTCTGGAGAGAGTCTGG - Exonic
1014093886 6:117438908-117438930 AGGTGTCACTTGAGAGAAGCTGG - Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020052142 7:5088679-5088701 CTGTTCTTCTGGAGAGAGGCGGG - Intergenic
1024095916 7:45982619-45982641 AGGTGATCCTGGTGAGAAGCCGG + Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1030737370 7:113065561-113065583 TGGTATATCTGGAGAGAAGAAGG + Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1034102023 7:148458218-148458240 AGGTGTGTCTGGAAAGTAGCTGG - Intergenic
1037645259 8:20787206-20787228 TGGTGTCTCTAGAGAGAGGCTGG + Intergenic
1039821396 8:41138472-41138494 CAGTGATACAGGAGAGAAGCTGG - Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1047198451 8:122742991-122743013 AGGTGTTTTTGGATAAAAGCTGG - Intergenic
1048940323 8:139394986-139395008 TGGTGTCTCTGGAGTCAAGCTGG + Intergenic
1049194132 8:141306375-141306397 ATGTGTTTCTAGAGAGAGGCTGG - Intronic
1049570492 8:143368188-143368210 CGGAGGTTCTGGAGGGAGGCGGG + Intergenic
1050197816 9:3106926-3106948 CAGTCTGTCTGGAGTGAAGCAGG - Intergenic
1051205056 9:14678968-14678990 CGGTTTTTCTGGAAAGAGACAGG + Intronic
1055191094 9:73525047-73525069 AGGTGTTTCTGTAGATAGGCAGG + Intergenic
1056133231 9:83605832-83605854 CGGGGTTTCTGGAAAGCAGCTGG - Intergenic
1056714719 9:89019915-89019937 CGGTTTTCAGGGAGAGAAGCTGG + Intronic
1057047322 9:91896353-91896375 TGGTGTTTCTGAAGATAAACTGG - Intronic
1060694857 9:125699954-125699976 TAGTGCTTCTGGAGAGATGCAGG - Intronic
1061054638 9:128215841-128215863 TGGTGTTGCTGGTGAGGAGCTGG + Intronic
1062154400 9:135038544-135038566 AGCTGTTTCTGGAGAGAGCCTGG - Intergenic
1062653681 9:137590974-137590996 GGGTGTTTCTGGAGAGACAGCGG + Intergenic
1185474515 X:406610-406632 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474536 X:406745-406767 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474603 X:407199-407221 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474688 X:407831-407853 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474704 X:407962-407984 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474762 X:408380-408402 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1198122928 X:133611830-133611852 TCATGTTTCTGGAGAGAGGCAGG + Intronic
1200148856 X:153941792-153941814 GGGGGTTTCTGCAGAGGAGCAGG - Intronic
1200228377 X:154431859-154431881 CGGTGTGTTTGGAAACAAGCAGG + Exonic