ID: 1166304511

View in Genome Browser
Species Human (GRCh38)
Location 19:41929831-41929853
Sequence CGGTCTCAGCACCTGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166304511_1166304517 26 Left 1166304511 19:41929831-41929853 CCAGCGCCCAGGTGCTGAGACCG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1166304517 19:41929880-41929902 TCAGCCCTGCCTGACAGAGAAGG 0: 1
1: 0
2: 0
3: 30
4: 319
1166304511_1166304515 -10 Left 1166304511 19:41929831-41929853 CCAGCGCCCAGGTGCTGAGACCG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1166304515 19:41929844-41929866 GCTGAGACCGAGGTGCTGAGAGG 0: 1
1: 0
2: 0
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166304511 Original CRISPR CGGTCTCAGCACCTGGGCGC TGG (reversed) Intronic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
904983866 1:34528464-34528486 CTGTCCCAGCACCTGGCTGCAGG + Intergenic
905358479 1:37401710-37401732 CATTCTCAGAACCTGGGGGCAGG + Intergenic
912775145 1:112502149-112502171 CGGGCGCAGCACCTGCGCGCCGG - Intronic
915608336 1:156969568-156969590 CTGTCTATGCACCTGGGCACAGG + Intronic
923090297 1:230735557-230735579 TGGTCTTAGCAGCTGGGCCCTGG + Intergenic
924455876 1:244218505-244218527 CAGCCTCAGGGCCTGGGCGCTGG + Intergenic
1062932071 10:1360161-1360183 CAGTCTCTGCACTTGGGTGCCGG - Intronic
1065893621 10:30141983-30142005 CGGTGTTAGCACCTGGGAGGTGG + Intergenic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1076373545 10:129969184-129969206 CGGCCCCAGCAGCTGGGCCCCGG + Intergenic
1076625289 10:131818096-131818118 CGGTCAGAGCACCTGGCCGAGGG - Intergenic
1077168064 11:1152594-1152616 CGGGGTCAGCACCTGGCGGCAGG + Intergenic
1077228635 11:1449043-1449065 CTGTCTGGGCACGTGGGCGCCGG + Intronic
1078521982 11:12070828-12070850 CTGTCTGAGCACATGGGCGTTGG + Intergenic
1081930967 11:46871129-46871151 CGGTCCCAGCATCTGGGCATAGG - Intronic
1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG + Intronic
1085021674 11:73213954-73213976 GGGTCTCAGCACCGGGTGGCAGG - Intergenic
1088513119 11:110598861-110598883 GGCTCTCAGGACCTGGGAGCAGG + Intronic
1089566719 11:119375651-119375673 AGGTCTCAGGAGCTGGGCTCTGG + Intronic
1094614560 12:32024404-32024426 CGATCTCAGCACTTTGGGGCGGG + Intergenic
1097029385 12:56080405-56080427 CGGGCTCGGCACCTGGGAGCCGG + Intronic
1103092062 12:118104286-118104308 CGGTCTGTGTCCCTGGGCGCAGG + Intronic
1103828634 12:123761895-123761917 AGGTCACAGCACCTCGGCGGTGG - Intergenic
1117172436 14:53114251-53114273 CGGACACAGCACCTGGGGGAAGG + Intronic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118881471 14:69830051-69830073 AGATCTCATCACCTGGGCCCTGG - Intergenic
1118881483 14:69830127-69830149 AGGTCTCATCACCTGGGCCCTGG - Intergenic
1122274761 14:100585896-100585918 CGGGCTCAGCACACGGGCTCTGG - Intronic
1122609534 14:102972357-102972379 TGGTCTCAGCACCTGAGCCCAGG - Intronic
1122649126 14:103216047-103216069 CGGCCTCAGCACCAGGCAGCAGG - Intergenic
1124956749 15:34365278-34365300 CGGTGTCTGAACCTGGGGGCGGG - Intronic
1131048879 15:89333680-89333702 CGGTTCCAGCTCCGGGGCGCTGG - Exonic
1132677353 16:1126299-1126321 CGGTTCCAGCACCGGGGAGCTGG - Intergenic
1134524850 16:14935501-14935523 TGGTCACACCACCTGGGAGCAGG + Intronic
1134565888 16:15251601-15251623 CGGTCACAGCTCCTGGCCACTGG - Intergenic
1134686110 16:16159713-16159735 CAGTCTGAGGACCTGGGCCCAGG + Intronic
1134712439 16:16333988-16334010 TGGTCACACCACCTGGGAGCAGG + Intergenic
1134736606 16:16505097-16505119 CGGTCACAGCTCCTGGCCACTGG + Intergenic
1134930908 16:18207071-18207093 CGGTCACAGCTCCTGGCCACTGG - Intergenic
1134954388 16:18374706-18374728 TGGTCACACCACCTGGGAGCAGG - Intergenic
1141217022 16:82034144-82034166 GGGTCACCGCACCTGGGCTCAGG - Intergenic
1141863437 16:86733606-86733628 CGGTCACAGCTCCTGTGGGCAGG + Intergenic
1142116381 16:88358237-88358259 AGGTCCGAGCCCCTGGGCGCTGG - Intergenic
1142367554 16:89657978-89658000 GCGTCTCCGCCCCTGGGCGCGGG + Intronic
1143528265 17:7484687-7484709 AGGTCTGAGCACCTAGGCGGAGG + Exonic
1145041775 17:19582504-19582526 CAGTCCCAGCTCCTGGGAGCAGG - Intergenic
1145042636 17:19588204-19588226 CAGTCCCAGCTCCTGGGAGCAGG + Intergenic
1146132682 17:30292117-30292139 CGGCCTCAGCCCCCGGGCGCTGG - Intergenic
1152192430 17:78896881-78896903 CGATCCCAGCACCTGGGCCCAGG + Intronic
1152268160 17:79308243-79308265 CAGGCCCAGCTCCTGGGCGCTGG + Intronic
1152584709 17:81183757-81183779 CGCTCACAGGACCTGGGGGCTGG - Intergenic
1153746244 18:8182831-8182853 CAGTCACAGCACTTGGGGGCAGG - Intronic
1155709302 18:28856225-28856247 CGATCCCAGCACCTGGGCACAGG - Intergenic
1160496249 18:79377520-79377542 CTGTCTCAGCATCTGTGCCCTGG - Exonic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1162534054 19:11252883-11252905 CGGGCTCAGCATCTGGTGGCCGG + Exonic
1163697017 19:18769128-18769150 CGTTCTCAGGGCCAGGGCGCAGG + Intronic
1164180195 19:22811540-22811562 GAGTCACAGCACCTGGGTGCTGG - Intergenic
1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG + Intergenic
1166084417 19:40465622-40465644 CGGGCTCACCACCCTGGCGCAGG - Exonic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1166898577 19:46040371-46040393 CACTCCCCGCACCTGGGCGCTGG + Exonic
929666280 2:43836571-43836593 CGTTCTCAGCAGCTGGGGGATGG - Intronic
929857851 2:45651247-45651269 CGGCCCCACCTCCTGGGCGCCGG - Intergenic
929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG + Intronic
932357556 2:71078744-71078766 CAGGCTGAGCACCTGGGGGCAGG - Exonic
932448654 2:71795866-71795888 AGGTTTCAGCACATGGGCACAGG - Intergenic
933728409 2:85438944-85438966 CGGCCTAAGTACCTGGGCCCAGG - Intergenic
937287229 2:120761329-120761351 TGGTCTCACCTCCTGGGCTCTGG - Intronic
937912361 2:127081786-127081808 GGGTCTCAGCAGCTGGGTGGTGG - Intronic
942134392 2:172910618-172910640 TGATCTGAGCACCTGGGGGCTGG + Intronic
945948076 2:216013412-216013434 CTGTCCCCGCACCTGGACGCTGG - Exonic
946329657 2:219002110-219002132 CGGTCTCAGAGCCCGGGCGGGGG - Intergenic
947395875 2:229686335-229686357 CTGACTCAGAACCTGGGTGCAGG - Intronic
948567915 2:238898123-238898145 CGGTCTCAGGGCCCGGGTGCTGG + Intronic
948673609 2:239584324-239584346 CGGGCTCAGAGCCTGGGCTCAGG + Exonic
1168866055 20:1087601-1087623 AGGCCTCAGCAACTGGGCCCTGG - Intergenic
1173945146 20:46944384-46944406 CGGTCTCCTCACCTGGGCAGTGG + Intronic
1178922096 21:36745449-36745471 TGTTCTCAGCACATGGGAGCTGG - Intronic
1179716431 21:43291082-43291104 CAGTGTCAGCACCCGGGCACGGG - Intergenic
1181346673 22:22224317-22224339 CACCCTCAGGACCTGGGCGCAGG - Intergenic
1181496585 22:23290626-23290648 CTGTCTCAGATCCTGGGAGCTGG + Intronic
1181921443 22:26323549-26323571 TGGTCTCAACACCTGAGCTCAGG - Intronic
1183912853 22:41092120-41092142 CGCTCCCAGCACCTGGCCGCCGG + Exonic
1184792684 22:46709515-46709537 CCCTGTCAGCACCTGGGGGCAGG + Intronic
1184807324 22:46803461-46803483 CCGCCTCAGCTCCTGGGGGCCGG - Intronic
1184836735 22:47028404-47028426 CGCTCTCAGAACCTGGGCCGTGG - Intronic
1184836750 22:47028461-47028483 CGCTCTCAGAACCTGGGCCGTGG - Intronic
950570588 3:13797383-13797405 GGGTGTCAGCACCTGGGGGCTGG - Intergenic
953356922 3:42263849-42263871 GGGTCTCTGCCCCTTGGCGCTGG - Intronic
953998212 3:47536632-47536654 CGGTCTGAGCACCCCGTCGCCGG - Intergenic
956881255 3:73513038-73513060 CTATCTCAGCACCTGGGAACTGG - Intronic
961009520 3:123426516-123426538 CGGTTTCACCACATTGGCGCAGG + Intronic
961652974 3:128426515-128426537 CGCTCTCGGCCGCTGGGCGCGGG - Intergenic
961654254 3:128432836-128432858 GGGTCTCAGCTTCTGGGCGCTGG + Intergenic
962722461 3:138188099-138188121 GCGTCCCAGCACCTGGGCACCGG + Intronic
973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG + Intronic
975544783 4:75549466-75549488 TGGTCTCAGGACCTTGGCACTGG + Intronic
985764443 5:1769380-1769402 CGGACTCAGGACCTGGCCCCAGG - Intergenic
985789039 5:1915580-1915602 AGGCCTCAGCACATGGGGGCAGG - Intergenic
986135630 5:4974999-4975021 GAGTCCCAGCACCTGGGCACAGG + Intergenic
990851592 5:60211061-60211083 CTTTCTCTCCACCTGGGCGCTGG + Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994072900 5:95621135-95621157 CAGGCTCTGCACCTTGGCGCGGG - Exonic
995048370 5:107673524-107673546 CGGGCTCACTTCCTGGGCGCTGG - Intergenic
997837021 5:137203274-137203296 TGAGCTCATCACCTGGGCGCTGG - Intronic
998039804 5:138944937-138944959 CGGGCTCAGCAGCCTGGCGCTGG + Intergenic
998117556 5:139549561-139549583 GGGCCTCAGCACCTGCCCGCAGG + Intronic
998514562 5:142741152-142741174 AGGACTCAGCATCTGGGAGCAGG - Intergenic
1002805265 6:567737-567759 GTGTCTCAGTACCTGGGCCCTGG + Intronic
1015966733 6:138701775-138701797 TGTTCTCAGCACCTGGGCTTAGG + Intergenic
1019186778 6:170225083-170225105 CTGCCTGAGCACCTGGGAGCTGG - Intergenic
1019285465 7:220950-220972 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285480 7:221013-221035 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285495 7:221076-221098 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285510 7:221139-221161 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285525 7:221202-221224 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285572 7:221391-221413 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285587 7:221454-221476 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285602 7:221517-221539 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285617 7:221580-221602 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285632 7:221643-221665 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285647 7:221706-221728 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285662 7:221769-221791 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285709 7:221958-221980 CGTTCTTAGCATCTGGGCACAGG + Intronic
1019285724 7:222021-222043 CGTTCTTAGCATCTGGGCACAGG + Intronic
1034243179 7:149624876-149624898 CGGGGTCAGCTCCCGGGCGCGGG - Intergenic
1034921968 7:155090817-155090839 GGGTCTCAGCAGCTGTGGGCAGG - Intergenic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1035735468 8:1884011-1884033 CGGAGTCAGCCCCTGGGAGCAGG + Intronic
1037769337 8:21789530-21789552 CGGCCTCGGCTCCTGGGCGCAGG - Intronic
1049006390 8:139858373-139858395 GGGTCTCAGCAGCTGGGCGGAGG - Intronic
1049860840 8:144897552-144897574 TGGTCTCAGCACCTGACCTCAGG - Intronic
1055719459 9:79155510-79155532 CTGTTTCACCACCTGGGGGCAGG + Intergenic
1056732440 9:89178008-89178030 GGGCCCCAGCACCTGGTCGCTGG + Exonic
1057628642 9:96701143-96701165 GGGACTTAGCACCTGGGCGACGG - Intergenic
1057713457 9:97468237-97468259 GGGTTTCAGGACCTGGGCCCAGG - Intronic
1060374351 9:123105306-123105328 CAGGCTGAGCACCTGGGGGCCGG + Intergenic
1060865329 9:126990571-126990593 CTGTCTCAGCACCTCCGCACAGG + Intronic
1061931982 9:133838048-133838070 CGGCCTCAGCGCCTGGCCGCTGG + Intronic
1185835733 X:3345313-3345335 CGGGCTCCGCCTCTGGGCGCTGG + Intronic
1189149875 X:38695585-38695607 CTGTCTCAGCACCTGGTAGTTGG + Intergenic
1190687551 X:52888119-52888141 CGATCTCAGGACCCGGGCCCAGG - Intergenic
1190698431 X:52967673-52967695 CGATCTCAGGACCCGGGCCCAGG + Intronic
1195135880 X:101906861-101906883 TGGTCTCAGCACCAGGCCCCAGG + Intronic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1200237104 X:154472933-154472955 CTGTCCCAACACCTGGGCACAGG - Exonic
1200253516 X:154566686-154566708 CTTTCTCAGCATCTGGGGGCGGG + Intergenic
1200264251 X:154637722-154637744 CTTTCTCAGCATCTGGGGGCGGG - Intergenic