ID: 1166304619

View in Genome Browser
Species Human (GRCh38)
Location 19:41930598-41930620
Sequence CTCCCAAAGGGTGTCCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166304619_1166304627 13 Left 1166304619 19:41930598-41930620 CCACACAGGACACCCTTTGGGAG No data
Right 1166304627 19:41930634-41930656 TCTGGGTAGATATGACTCCTTGG No data
1166304619_1166304624 -4 Left 1166304619 19:41930598-41930620 CCACACAGGACACCCTTTGGGAG No data
Right 1166304624 19:41930617-41930639 GGAGAAAGGTGACACCCTCTGGG No data
1166304619_1166304623 -5 Left 1166304619 19:41930598-41930620 CCACACAGGACACCCTTTGGGAG No data
Right 1166304623 19:41930616-41930638 GGGAGAAAGGTGACACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166304619 Original CRISPR CTCCCAAAGGGTGTCCTGTG TGG (reversed) Intergenic
No off target data available for this crispr