ID: 1166307286

View in Genome Browser
Species Human (GRCh38)
Location 19:41941848-41941870
Sequence CTCATTTTGACTTGAGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166307286_1166307290 2 Left 1166307286 19:41941848-41941870 CCTCAGACTCAAGTCAAAATGAG No data
Right 1166307290 19:41941873-41941895 TCTGGGCCTCACCCACCCTAAGG No data
1166307286_1166307296 24 Left 1166307286 19:41941848-41941870 CCTCAGACTCAAGTCAAAATGAG No data
Right 1166307296 19:41941895-41941917 GCTCCCCCAAACTAGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166307286 Original CRISPR CTCATTTTGACTTGAGTCTG AGG (reversed) Intergenic
No off target data available for this crispr