ID: 1166309682

View in Genome Browser
Species Human (GRCh38)
Location 19:41955977-41955999
Sequence CTGGGTGCACAGTTGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166309675_1166309682 6 Left 1166309675 19:41955948-41955970 CCACAACAGACTGCTGTCCTTAG No data
Right 1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG No data
1166309674_1166309682 17 Left 1166309674 19:41955937-41955959 CCTGGCAGGCTCCACAACAGACT No data
Right 1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166309682 Original CRISPR CTGGGTGCACAGTTGGTCCT TGG Intergenic
No off target data available for this crispr