ID: 1166309682 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:41955977-41955999 |
| Sequence | CTGGGTGCACAGTTGGTCCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166309675_1166309682 | 6 | Left | 1166309675 | 19:41955948-41955970 | CCACAACAGACTGCTGTCCTTAG | No data | ||
| Right | 1166309682 | 19:41955977-41955999 | CTGGGTGCACAGTTGGTCCTTGG | No data | ||||
| 1166309674_1166309682 | 17 | Left | 1166309674 | 19:41955937-41955959 | CCTGGCAGGCTCCACAACAGACT | No data | ||
| Right | 1166309682 | 19:41955977-41955999 | CTGGGTGCACAGTTGGTCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166309682 | Original CRISPR | CTGGGTGCACAGTTGGTCCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||