ID: 1166310543

View in Genome Browser
Species Human (GRCh38)
Location 19:41959914-41959936
Sequence GGGGGCCATGGTTGCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166310534_1166310543 0 Left 1166310534 19:41959891-41959913 CCTCAAGAGATTGAGGCTAGTGA No data
Right 1166310543 19:41959914-41959936 GGGGGCCATGGTTGCTGGAGGGG No data
1166310533_1166310543 4 Left 1166310533 19:41959887-41959909 CCTTCCTCAAGAGATTGAGGCTA No data
Right 1166310543 19:41959914-41959936 GGGGGCCATGGTTGCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166310543 Original CRISPR GGGGGCCATGGTTGCTGGAG GGG Intergenic