ID: 1166313309

View in Genome Browser
Species Human (GRCh38)
Location 19:41975460-41975482
Sequence GTCTTCCTCCCCTGTGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 236}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166313309_1166313316 6 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313316 19:41975489-41975511 GGACAGGCTCAGGCTCCTCCAGG 0: 1
1: 0
2: 1
3: 35
4: 316
1166313309_1166313321 15 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313321 19:41975498-41975520 CAGGCTCCTCCAGGGCCAGGGGG 0: 1
1: 0
2: 2
3: 58
4: 444
1166313309_1166313315 -4 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313315 19:41975479-41975501 AGACAGAAAAGGACAGGCTCAGG 0: 1
1: 0
2: 6
3: 62
4: 555
1166313309_1166313318 12 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313318 19:41975495-41975517 GCTCAGGCTCCTCCAGGGCCAGG 0: 1
1: 0
2: 3
3: 65
4: 502
1166313309_1166313323 22 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313323 19:41975505-41975527 CTCCAGGGCCAGGGGGCCTGTGG 0: 1
1: 0
2: 4
3: 62
4: 627
1166313309_1166313320 14 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313320 19:41975497-41975519 TCAGGCTCCTCCAGGGCCAGGGG 0: 1
1: 0
2: 2
3: 41
4: 354
1166313309_1166313319 13 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313319 19:41975496-41975518 CTCAGGCTCCTCCAGGGCCAGGG 0: 1
1: 1
2: 2
3: 61
4: 501
1166313309_1166313317 7 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313317 19:41975490-41975512 GACAGGCTCAGGCTCCTCCAGGG 0: 1
1: 0
2: 3
3: 25
4: 259
1166313309_1166313314 -10 Left 1166313309 19:41975460-41975482 CCGACCCCACAGGGGAGGAAGAC 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1166313314 19:41975473-41975495 GGAGGAAGACAGAAAAGGACAGG 0: 1
1: 2
2: 7
3: 135
4: 1145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166313309 Original CRISPR GTCTTCCTCCCCTGTGGGGT CGG (reversed) Intronic
901127576 1:6940424-6940446 GGCTTCCTCCCCAGTGTGGGGGG - Intronic
901782246 1:11601822-11601844 GTCTTCCTCCCCAGAGGGTGAGG - Intergenic
902918425 1:19652496-19652518 CCCTTCCTCCCCAGTGGGCTGGG + Intronic
902943454 1:19816576-19816598 GGCTCCCTCCCTTGTGGGATCGG + Intergenic
902951881 1:19890777-19890799 GACTTCTTACTCTGTGGGGTGGG + Intronic
904383817 1:30128921-30128943 GTCTTCCTCTCTTGTGGGGAAGG - Intergenic
904401232 1:30257997-30258019 AACCTCCTCCCCTGTGGAGTGGG - Intergenic
904424719 1:30415926-30415948 ACCTTCCTGCCCTGTGGGGTGGG + Intergenic
904455077 1:30642644-30642666 GACCTCCTCCCCTGTGGAGTGGG - Intergenic
905213852 1:36393020-36393042 GCCCTCCTCCCCTGGGGTGTGGG - Intronic
905394826 1:37660587-37660609 GTCTCCCTCCCCAGGAGGGTCGG - Intergenic
907913162 1:58844653-58844675 GTATGCCACCCCTGTGGAGTGGG + Intergenic
910085638 1:83398979-83399001 GTCTTGCCCCCGTTTGGGGTGGG + Intergenic
912529673 1:110311201-110311223 GTCTGTCTCCCATCTGGGGTTGG + Intergenic
916661161 1:166923345-166923367 GACTTCCTGCTCTGTGGGGAGGG - Intronic
916831597 1:168497847-168497869 GTCTTGCACCCTTGTGGGGCTGG - Intergenic
917133274 1:171763707-171763729 GTCTTCCTCCCTTCTGGGTAAGG + Intergenic
921094630 1:211875704-211875726 ATCTTCATCCCCTGGTGGGTGGG - Intergenic
922493024 1:226033884-226033906 ATCTTCCTCACCTCTTGGGTAGG - Intergenic
924242751 1:242056745-242056767 ATTTTCCTCCCCTGTGGGAGGGG - Intergenic
924772291 1:247088538-247088560 GTCTGCCTCCCCTGGGGAGGAGG + Intergenic
1062843398 10:688217-688239 GTCTTCCAGGCCTGTGGGCTTGG - Intronic
1064863206 10:19849921-19849943 GTCTGCTTCACCTGTGGTGTGGG + Intronic
1065875189 10:29991707-29991729 GTTTTCCTCCCCAGTGTGGATGG - Intergenic
1067077360 10:43195787-43195809 GTCTTCCTGCTCTGTGGTTTGGG - Exonic
1068028894 10:51683541-51683563 GTCTTCCTGCCCTGGGGTTTGGG + Intronic
1069673997 10:70234070-70234092 GTCACCCTCCCCAGTGGGGGAGG + Intergenic
1070652985 10:78251598-78251620 AGCTTCCTCGCCTGTGAGGTGGG - Intergenic
1070843248 10:79502697-79502719 GTTTGCCTCCTCTGTGGGGTGGG - Intergenic
1070930423 10:80256939-80256961 GTTTGCCTCCTCTGTGGGGTGGG + Intergenic
1072686575 10:97540999-97541021 GTCTTGCTGCCCTGGGGAGTTGG + Intronic
1072825452 10:98601649-98601671 GTATTCCTCCCCGCAGGGGTGGG - Intronic
1073074381 10:100814673-100814695 ACCTTTCTCCCCAGTGGGGTGGG + Intronic
1074532928 10:114309432-114309454 GTTTTCCTCCCTGCTGGGGTGGG + Intronic
1076562562 10:131376810-131376832 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076562579 10:131376869-131376891 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076562596 10:131376928-131376950 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076562613 10:131376987-131377009 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076562630 10:131377046-131377068 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076562647 10:131377105-131377127 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076562664 10:131377164-131377186 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076562681 10:131377223-131377245 ATCCTCCTCCCCTGTGGGCCTGG - Intergenic
1076595455 10:131622347-131622369 GGCTTCCTCCCCTGTGACCTGGG - Intergenic
1077415315 11:2421970-2421992 GTCTGGCTGCCGTGTGGGGTGGG + Intronic
1077415335 11:2422029-2422051 GTCTGGCTGCCCTGTGGGGTGGG + Intronic
1077415355 11:2422089-2422111 GTCGGGCTGCCCTGTGGGGTGGG + Intronic
1077897621 11:6465489-6465511 ATCCTCCTCCCCTGTGGGGAGGG - Intronic
1078390168 11:10930531-10930553 GGTTTCCTCCTCTGTGAGGTGGG + Intergenic
1079099271 11:17530853-17530875 GTCTTCCTCTCTTGGGGAGTAGG + Intronic
1080589896 11:33713443-33713465 GTCCTCCTCCTCTGAGGGGATGG + Intronic
1080897439 11:36458341-36458363 GTCTTCCTCATCTGTGCAGTGGG + Intronic
1081141086 11:39501191-39501213 GTCTTCCACACCTCTGGGGCAGG + Intergenic
1081795718 11:45818000-45818022 TTTGTCCTCCCCTGTGAGGTTGG - Intergenic
1083618777 11:64038880-64038902 GTCTTCCTCATCTGTAGGGTGGG + Intronic
1084234102 11:67775259-67775281 GCCTTCCTCATCTCTGGGGTGGG - Intergenic
1089622613 11:119730166-119730188 GTCTTCCTCCCCCAGGGGGAGGG - Intergenic
1089834653 11:121359369-121359391 TTCTTCCTCTTCTGAGGGGTCGG - Intergenic
1091288824 11:134425315-134425337 GTCTTCCTCCTCTTTGCTGTGGG + Intergenic
1091747767 12:3003630-3003652 GCCTTCGCCCCCGGTGGGGTGGG + Intronic
1092786574 12:12032301-12032323 GTCTTTCTCCCAGGCGGGGTGGG - Intergenic
1096103580 12:48983864-48983886 CTGATCCTCCCCTGTGGGGAGGG - Intergenic
1096463277 12:51834541-51834563 GTCTGGCTCCTCTCTGGGGTGGG + Intergenic
1096532911 12:52253176-52253198 CTCTTCCTACACTGAGGGGTGGG + Intronic
1096542590 12:52316431-52316453 CTCTTCCTACACTGAGGGGTGGG + Intronic
1100450968 12:94706143-94706165 AGCTTCCATCCCTGTGGGGTTGG + Intergenic
1100455009 12:94743203-94743225 CACTTCCTCCCCTGTGAGGCAGG + Intergenic
1101584182 12:106070232-106070254 CTCTTTCACCCCTGTGGGTTGGG - Intronic
1102911015 12:116714160-116714182 GTCTTCCTCCTCTGTGGCTCAGG - Exonic
1103931358 12:124452752-124452774 GCCTTCCTCCCCTGTGGCTTTGG - Intronic
1104892680 12:132148022-132148044 GTCTGCCTCCCCTGCGGGTCAGG + Intronic
1104898508 12:132175778-132175800 CTCCTCCTCCCGTGTGGGGCTGG - Intergenic
1105027531 12:132859000-132859022 TTCTTCGTCCCGTGTGGGGCAGG - Intronic
1105830494 13:24160193-24160215 CTCTTCCCGCCCTGGGGGGTGGG + Intronic
1105958029 13:25301974-25301996 GGCTTCCTTCCCAGTGGGGCTGG + Intronic
1106448454 13:29857975-29857997 GTGTTTCTCCCCTCTGGGGTGGG + Intergenic
1107186667 13:37530162-37530184 GTCCTCCTCTCCTGTAAGGTTGG - Intergenic
1107460438 13:40596951-40596973 GTCTTCCTCCCCTTTGGGGTAGG - Intronic
1109643561 13:65223089-65223111 GCCTACCTCCCCAGTGAGGTAGG + Intergenic
1112691927 13:101906137-101906159 GTCTTGCTTCTCTCTGGGGTGGG - Intronic
1113762474 13:112859300-112859322 TCCCTCCTCCCATGTGGGGTGGG + Intronic
1117162298 14:53001537-53001559 ATCCTCCTGCCTTGTGGGGTAGG + Intergenic
1117302724 14:54444531-54444553 GTGTTCCTACACTCTGGGGTGGG - Intergenic
1120533321 14:85661088-85661110 GTCTTTCTTCCCTGTTTGGTTGG - Intergenic
1122202194 14:100129389-100129411 GGTTTTCTCCCCTGTGGGGTTGG + Intronic
1123702459 15:22925654-22925676 GTCTTGCTCTCCTGTGAGGCAGG - Intronic
1124657814 15:31523255-31523277 GTCTGTGTCCCCTGTGGGGCCGG + Intronic
1124899707 15:33810726-33810748 GTCCTCCTCCCCTGGGGGGCGGG + Intronic
1126173680 15:45715833-45715855 ATCCTCCTCTCCTGTGGGATTGG - Intergenic
1128614869 15:69101184-69101206 GCCATCCTCCCCTTTGGGGCTGG - Intergenic
1130851850 15:87802597-87802619 GCTTCCCTCCCCAGTGGGGTGGG + Intergenic
1132288243 15:100681467-100681489 GAATTCCTCCCATGAGGGGTAGG - Intergenic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132830470 16:1925557-1925579 GTCTCCCAGCCCTGTGGGGAGGG + Intergenic
1133226475 16:4343174-4343196 GTCCGTCTCCCCTGTGGGCTGGG - Intronic
1133335304 16:5003321-5003343 CTGTTCATCCCCTGTGGGGAGGG + Intronic
1134078525 16:11308946-11308968 TTCTGCCTGCTCTGTGGGGTGGG + Intronic
1136402051 16:30024484-30024506 GGCTTCCTCCAATCTGGGGTCGG - Exonic
1141700187 16:85638819-85638841 GTGTGCTTCCCCGGTGGGGTTGG + Intronic
1141948176 16:87324393-87324415 TGCTTCCTCTCCTGTGGAGTGGG + Intronic
1142388159 16:89780138-89780160 GTCATCCTCCCCTGTCGTGCTGG - Intronic
1142507038 17:371076-371098 TTCTTCCTCCGTTGTGGGGCTGG + Intronic
1144775824 17:17784162-17784184 GGCTTCCTCCCCTGGGGACTGGG + Intronic
1146411284 17:32587766-32587788 GCCTCCCTTCCCTGTGGGATTGG + Intronic
1147424253 17:40338298-40338320 CTCCTCCTCCTCTGTGGAGTTGG + Intronic
1152305936 17:79520167-79520189 CGCCTCCTCCCCTGTGGAGTGGG + Intergenic
1152334957 17:79695494-79695516 GCCCTGCTCCCCTGGGGGGTGGG + Intergenic
1152614494 17:81331530-81331552 GTCGCCCTCCGCTGTGGGCTAGG - Intergenic
1153435930 18:5067736-5067758 GTCTTCCTCCTGTGTGGGCATGG + Intergenic
1153562584 18:6386123-6386145 GGCTTTCTCCCCTGTGTGCTTGG - Intronic
1157579397 18:48764664-48764686 GGCTTCCTCCACTGTGGGGGAGG - Intronic
1159016804 18:63107699-63107721 GTGTTTCTCCTCTTTGGGGTGGG - Intergenic
1160378680 18:78432303-78432325 GTCTTCCTCCCACATGTGGTGGG + Intergenic
1160544309 18:79642453-79642475 TTTTTCTTCCCCTCTGGGGTTGG + Intergenic
1161342656 19:3751543-3751565 GACTTCGTCTCCTGTGGGGCGGG + Exonic
1161509187 19:4661306-4661328 GCCTCTCTCCCCTGTGGGCTGGG + Intronic
1162552571 19:11365711-11365733 GCCTTCCTCCCCCGGGTGGTGGG + Intergenic
1163848601 19:19651142-19651164 AGCTTCCTCCTCTGTGGTGTGGG + Intronic
1163860849 19:19742215-19742237 ATCTACCTCCCCCGGGGGGTGGG - Intergenic
1164536053 19:29087377-29087399 GGCTTCCTCACCTCTGGAGTAGG - Intergenic
1165538632 19:36471697-36471719 CTCTCCCTACACTGTGGGGTAGG + Intronic
1166137612 19:40786836-40786858 GTCTAGCTCGCCTGTGGGGAAGG - Exonic
1166313309 19:41975460-41975482 GTCTTCCTCCCCTGTGGGGTCGG - Intronic
1166834610 19:45659595-45659617 GTCTTCCTCTCCTGTCTGTTGGG - Intergenic
1167522611 19:49964825-49964847 TTCATCATCTCCTGTGGGGTTGG + Intergenic
1167736092 19:51295350-51295372 GTGTTCCTGACCTGTGGGGAGGG - Intergenic
1168164638 19:54538231-54538253 CTCTTCCTCCCCTGTGGATGAGG - Intronic
1168310825 19:55459734-55459756 CTCTTCCTCCCCTGTGCAGGAGG + Intronic
925495688 2:4446580-4446602 ATCTTCCTAACCTGTGAGGTGGG + Intergenic
928039918 2:27864821-27864843 CTCCTTCTCCCCTCTGGGGTGGG + Intronic
928088258 2:28359013-28359035 GTCTTCCTTCCCTGTGTGGGTGG + Intergenic
931119176 2:59197408-59197430 TTTTACCTCCCCTGTGGGATAGG + Intergenic
932135644 2:69226352-69226374 GTCCTCATCCCCTGTGGAATGGG + Intronic
932888126 2:75565544-75565566 GATTTCCTACCTTGTGGGGTAGG - Intronic
933686482 2:85145657-85145679 GTGCTCCTCACCTGTTGGGTGGG - Intronic
933703082 2:85269938-85269960 TTCTTGTTCACCTGTGGGGTCGG + Intronic
933970813 2:87468602-87468624 CCCCTCCTCCCCTGTTGGGTGGG + Intergenic
934572141 2:95379475-95379497 GGCTTCCTCCCCTGTCTGCTGGG + Intronic
935865380 2:107382052-107382074 AGCTTGCTCCCCTGTGGGGAAGG - Intergenic
936322917 2:111481594-111481616 CCCCTCCTCCCCTGTTGGGTGGG - Intergenic
936346293 2:111677747-111677769 GTCTGCCTTCCCTGGGGGTTTGG + Intergenic
937973178 2:127565563-127565585 GGCTTCCTCCCCTCCAGGGTGGG - Intronic
947189391 2:227486247-227486269 GTCTTTCTTTTCTGTGGGGTGGG + Intronic
948164320 2:235849801-235849823 GTCTTCCTCCCCTCCAGGGGCGG - Intronic
948261897 2:236610472-236610494 GGGTTCTTCCCCTGTGGGGAGGG + Intergenic
948566068 2:238887150-238887172 CTCTTCCTCCTCTAAGGGGTGGG - Intronic
948748818 2:240116108-240116130 GTCCTCCTCCCTTGGTGGGTGGG + Intergenic
1170158002 20:13286014-13286036 GTTTGCATCACCTGTGGGGTGGG - Intronic
1172251078 20:33479648-33479670 GAATGCCTCCCCCGTGGGGTGGG + Intergenic
1172814858 20:37678360-37678382 GGGTTTCTCCCCTGTGGGGCAGG - Intergenic
1173599073 20:44280018-44280040 GTTTTTCTACCCTGTGAGGTGGG + Exonic
1174198999 20:48794070-48794092 GTCCTCCCACTCTGTGGGGTAGG - Intronic
1174787575 20:53446928-53446950 GCCTTCCTCCCCTCTAGGGCTGG + Intronic
1175190675 20:57210509-57210531 GTCTTACTCCCCTGGGAGGCGGG - Intronic
1175916934 20:62430355-62430377 GGCTGCCTCACCTCTGGGGTGGG - Intergenic
1178369108 21:32012234-32012256 TTCATCCTCCCCTCTGGAGTTGG - Intronic
1178420278 21:32437704-32437726 GCCTTCCTCATCTCTGGGGTGGG + Intronic
1180163075 21:46006712-46006734 GGCTTCCTCCCCTGTAAGCTGGG + Intergenic
1181055300 22:20258094-20258116 GGCTTTCTCCTCTGTGGGGTGGG - Intronic
1181179211 22:21055384-21055406 CCCTTCCTCCTCTGTGGGCTGGG + Intronic
1181960171 22:26617054-26617076 GTCTGCTTCCTCTGAGGGGTTGG + Intronic
1181981439 22:26769580-26769602 GTCTTCCTCACCTGTGCAATGGG - Intergenic
1182095542 22:27623000-27623022 CGCTTCCTCCCCACTGGGGTTGG - Intergenic
1182416776 22:30226399-30226421 GTCTTCCTCCTCTGAGGAGCAGG - Intergenic
1183417101 22:37688838-37688860 ATCTGCCTCCTCTGTGGGGGTGG - Exonic
1183852489 22:40602532-40602554 GTCTTGCTCTCCTATGTGGTTGG + Intronic
1184308187 22:43623570-43623592 GTCTTCCTGCCCTCTTGGTTGGG - Intronic
1185107923 22:48884926-48884948 CTCCTCCTCCCCTGTGAGTTGGG + Intergenic
950252783 3:11480645-11480667 TTCTGCCTCCCCTCTGGGCTGGG + Intronic
952018322 3:28986215-28986237 GTCATACTGCCCTCTGGGGTAGG + Intergenic
952404341 3:32992223-32992245 CTCTTCCTCCCCTTTGGGTCTGG + Intergenic
953715771 3:45315860-45315882 ATATTCCTCCCTTCTGGGGTGGG - Intergenic
954448040 3:50557156-50557178 GTCCTCCCACCCTGTTGGGTGGG - Intergenic
954684169 3:52361562-52361584 GGCTTCCTCCCAAGTGGAGTTGG + Intronic
954718995 3:52543733-52543755 CTCTACCTCCACTGTGGTGTTGG + Intronic
955421464 3:58742562-58742584 GTCTTCTTCACCTGTGGGGAAGG + Exonic
955947177 3:64206583-64206605 TTCCACCTCCCCTGTGGTGTGGG + Intronic
959991039 3:112632632-112632654 CTTATCCTCCCCTGTGTGGTAGG + Intronic
960076820 3:113495570-113495592 ATCTACCACCCCTGTGGGGCTGG - Intronic
960461743 3:117943966-117943988 GACTTCTGCCCCAGTGGGGTTGG + Intergenic
960659853 3:120045560-120045582 GTGTCACTCCCCTGTGGGCTGGG - Intronic
961195809 3:125000437-125000459 GTTGTCCTCCCCAGTGAGGTAGG - Intronic
961350752 3:126300460-126300482 GTCTTCCTCCACTGCACGGTAGG + Intergenic
961883728 3:130081802-130081824 GCCTTCCTCATCTCTGGGGTGGG - Intergenic
962748336 3:138414238-138414260 CTCTGCCTCCCTTGTGGGGCAGG + Intergenic
965322475 3:167266609-167266631 GTGTTCTTCCCCCGTGGGCTGGG - Intronic
966668425 3:182499053-182499075 CTCTTCCTCCTCTGTGGTCTAGG + Intergenic
966780951 3:183583895-183583917 GGTTTCCTTCCCTGTGGGGCTGG - Intergenic
967703221 3:192619222-192619244 TCCTTCCTCCCCTGATGGGTGGG + Intronic
967708323 3:192678225-192678247 GTGTTCCTCACCTGTGAGGTGGG - Intronic
968452835 4:683241-683263 GTGTTCCTTCCCCGTGGGGGAGG - Exonic
969030581 4:4209861-4209883 GTCTTTCTTCACAGTGGGGTAGG - Intronic
969312130 4:6359790-6359812 GTCGTCCTCTCCTGTAAGGTGGG + Intronic
969821045 4:9720501-9720523 GCCTTCCTCGTCTCTGGGGTGGG + Intergenic
972247421 4:37259836-37259858 GTCTTCCTCCCCTCCAGGGAAGG + Intronic
980197863 4:129614476-129614498 AGCTTCCTCAGCTGTGGGGTTGG - Intergenic
984760846 4:183361392-183361414 GCCTTCCTCCCCTCTGGAGGAGG + Intergenic
985665703 5:1180665-1180687 CTCTGGGTCCCCTGTGGGGTGGG + Intergenic
985802490 5:2013849-2013871 GTCTCCCGTCCCTGTGGAGTGGG - Intergenic
987427673 5:17792255-17792277 GTCCTCCTGCCCTGTGGAGAAGG + Intergenic
987948389 5:24645031-24645053 GTCTTTCTGCCCTGCGGGGGAGG - Intergenic
988531967 5:32035805-32035827 ATCTTCCTCCCAATTGGGGTTGG - Intronic
991390185 5:66134463-66134485 ACCTGCCTCCCCTGTGGTGTGGG - Intergenic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
993800201 5:92324065-92324087 TTCTTGCTTCCCAGTGGGGTAGG - Intergenic
993851454 5:93015347-93015369 CTCAGCCTCCCCAGTGGGGTGGG + Intergenic
997283794 5:132664412-132664434 GCCTTCCTCCCTTGAGGGTTTGG - Intergenic
999393143 5:151208844-151208866 TGCTTCCTCCTCTGTGAGGTGGG + Intronic
1002148331 5:177204803-177204825 TTTTTCCTCCCCAGTGGGCTGGG + Intronic
1003490823 6:6620056-6620078 GTCTTCCTCCTCTCAGGGGAAGG - Intronic
1005849912 6:29813517-29813539 ATCTTCTTCGCCTGTGGAGTAGG + Intergenic
1006581619 6:35080842-35080864 GTCTGACACCCCTGTGGTGTTGG + Intronic
1007396954 6:41583387-41583409 CTCAGCCTCACCTGTGGGGTAGG - Intronic
1017343452 6:153353351-153353373 TTCCTCCTCCCTGGTGGGGTTGG + Intergenic
1019781750 7:2944527-2944549 GCCTTCCTCCACTGTGGAGAGGG + Exonic
1020317708 7:6918338-6918360 GCCTTCCTCATCTCTGGGGTGGG - Intergenic
1021891938 7:25194673-25194695 GTCTTCCCCACCTGTGTGGCAGG - Intergenic
1024786754 7:52916366-52916388 GTTTTCCTTCCCTTTGGGTTTGG + Intergenic
1027302511 7:76855439-76855461 GTCTTGCCCCCGTTTGGGGTGGG + Intergenic
1028013816 7:85681863-85681885 GACATCCTCCCCTGTGTGGAAGG + Intergenic
1029191834 7:98777484-98777506 TTCTCCCTCCCCCATGGGGTTGG + Intergenic
1029524958 7:101088659-101088681 GTCTGCCACCCCTGTGGGGCTGG - Exonic
1030891299 7:115002614-115002636 CTCTTCTTCCCCTGAGGGGGAGG - Intronic
1033583035 7:142753713-142753735 GTCTTCTTTGCCTTTGGGGTAGG + Intronic
1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG + Intergenic
1033751544 7:144364851-144364873 GTGTCCCTCCTCTGTGGGGGAGG - Exonic
1035402775 7:158577925-158577947 ATCTTCCTGGCCTGTGGGGATGG - Intronic
1037042121 8:14249137-14249159 TTCTTCCTCCCCAGTGTAGTTGG + Intronic
1039509275 8:38077848-38077870 GGCTGCTTCCCCAGTGGGGTTGG + Intergenic
1041253914 8:55962514-55962536 GTCTTCATCCCATGTCGTGTTGG + Intronic
1047214416 8:122864895-122864917 GTCTTCTTCCCCTGGGGTCTGGG + Intronic
1048223851 8:132566422-132566444 GGCTTCCTGCTCTGCGGGGTTGG + Intergenic
1048339743 8:133529450-133529472 GTCTGCCTCCCCTGTTAGCTGGG - Intronic
1049701689 8:144017440-144017462 GTGTTCCTCCTCAATGGGGTTGG - Intronic
1050290514 9:4149288-4149310 GTTTTCCTCCCCTGTGAAATGGG - Intronic
1050416921 9:5427996-5428018 GTCATACTCCCTTCTGGGGTGGG + Intronic
1051556606 9:18390686-18390708 GTTTTCCTCCACTGGGAGGTGGG - Intergenic
1052541368 9:29816125-29816147 GTCTTCCTTTCCTGTGGGAGTGG - Intergenic
1052983351 9:34465614-34465636 GTTTTCCTCCCCTGTGTACTAGG + Intronic
1053180205 9:35962136-35962158 CCCTTCCTCGCCTGTGGAGTGGG + Intergenic
1057296914 9:93851714-93851736 GGCTGCCTCCTCTCTGGGGTAGG + Intergenic
1058221788 9:102312580-102312602 TTGTACCTCCCATGTGGGGTGGG + Intergenic
1058658970 9:107251412-107251434 GTCCTCCTCCTCTGTGGGAAAGG - Intergenic
1058766251 9:108185300-108185322 GTCCTCCTGCCCTGTGGCCTGGG - Intergenic
1059312405 9:113397395-113397417 GTCTTCCTCCTTGGTAGGGTGGG + Intronic
1059381922 9:113933697-113933719 GTGTTCTTCCAGTGTGGGGTAGG + Intronic
1059433114 9:114261487-114261509 CTCTCCCTGCCCTGTGGGGCTGG + Intronic
1059887230 9:118759628-118759650 GTGTTTCTCCCCTCTGGAGTAGG - Intergenic
1060554566 9:124501606-124501628 ATCTTCCTGCCCCCTGGGGTGGG + Intronic
1061040388 9:128138300-128138322 GTCTCGCTCTCCTGAGGGGTGGG - Intergenic
1061358226 9:130122511-130122533 TTCCTCCTCCCCTGAGGGATGGG - Intronic
1187197283 X:17099785-17099807 GTCATCATCCTCTTTGGGGTAGG + Intronic
1188117525 X:26263558-26263580 TTCTCCCTCCCCTCAGGGGTTGG - Intergenic
1196895881 X:120334986-120335008 GTCTTCCTCCCCTGGGTCGTGGG + Intergenic
1199641847 X:149869441-149869463 GTCAGCCTGCCCAGTGGGGTTGG - Intergenic