ID: 1166313644

View in Genome Browser
Species Human (GRCh38)
Location 19:41976647-41976669
Sequence GAGGGGCCAGCCCCACAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166313640_1166313644 -4 Left 1166313640 19:41976628-41976650 CCTGAAAGACAGAGAAACAGAGG 0: 3
1: 1
2: 11
3: 102
4: 783
Right 1166313644 19:41976647-41976669 GAGGGGCCAGCCCCACAACCAGG 0: 1
1: 0
2: 2
3: 32
4: 422
1166313639_1166313644 -3 Left 1166313639 19:41976627-41976649 CCCTGAAAGACAGAGAAACAGAG 0: 1
1: 0
2: 9
3: 129
4: 923
Right 1166313644 19:41976647-41976669 GAGGGGCCAGCCCCACAACCAGG 0: 1
1: 0
2: 2
3: 32
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166313644 Original CRISPR GAGGGGCCAGCCCCACAACC AGG Intronic