ID: 1166313644 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:41976647-41976669 |
| Sequence | GAGGGGCCAGCCCCACAACC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 457 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 32, 4: 422} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166313640_1166313644 | -4 | Left | 1166313640 | 19:41976628-41976650 | CCTGAAAGACAGAGAAACAGAGG | 0: 3 1: 1 2: 11 3: 102 4: 783 |
||
| Right | 1166313644 | 19:41976647-41976669 | GAGGGGCCAGCCCCACAACCAGG | 0: 1 1: 0 2: 2 3: 32 4: 422 |
||||
| 1166313639_1166313644 | -3 | Left | 1166313639 | 19:41976627-41976649 | CCCTGAAAGACAGAGAAACAGAG | 0: 1 1: 0 2: 9 3: 129 4: 923 |
||
| Right | 1166313644 | 19:41976647-41976669 | GAGGGGCCAGCCCCACAACCAGG | 0: 1 1: 0 2: 2 3: 32 4: 422 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166313644 | Original CRISPR | GAGGGGCCAGCCCCACAACC AGG | Intronic | ||