ID: 1166316873

View in Genome Browser
Species Human (GRCh38)
Location 19:41994247-41994269
Sequence GACGCGGGCATATGAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166316873_1166316892 27 Left 1166316873 19:41994247-41994269 CCGCCTCCTCATATGCCCGCGTC 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1166316892 19:41994297-41994319 CAGGGGCGCCGCCGTGCTGACGG 0: 1
1: 0
2: 0
3: 6
4: 102
1166316873_1166316887 -1 Left 1166316873 19:41994247-41994269 CCGCCTCCTCATATGCCCGCGTC 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1166316887 19:41994269-41994291 CCGCGGGAGGGGGGCGGCGCTGG 0: 1
1: 0
2: 10
3: 95
4: 889
1166316873_1166316890 10 Left 1166316873 19:41994247-41994269 CCGCCTCCTCATATGCCCGCGTC 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1166316890 19:41994280-41994302 GGGCGGCGCTGGCCAATCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 91
1166316873_1166316888 8 Left 1166316873 19:41994247-41994269 CCGCCTCCTCATATGCCCGCGTC 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1166316888 19:41994278-41994300 GGGGGCGGCGCTGGCCAATCAGG 0: 1
1: 0
2: 2
3: 7
4: 141
1166316873_1166316889 9 Left 1166316873 19:41994247-41994269 CCGCCTCCTCATATGCCCGCGTC 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1166316889 19:41994279-41994301 GGGGCGGCGCTGGCCAATCAGGG 0: 1
1: 0
2: 0
3: 12
4: 80
1166316873_1166316885 -7 Left 1166316873 19:41994247-41994269 CCGCCTCCTCATATGCCCGCGTC 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1166316885 19:41994263-41994285 CCGCGTCCGCGGGAGGGGGGCGG 0: 1
1: 0
2: 3
3: 43
4: 322
1166316873_1166316882 -10 Left 1166316873 19:41994247-41994269 CCGCCTCCTCATATGCCCGCGTC 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1166316882 19:41994260-41994282 TGCCCGCGTCCGCGGGAGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166316873 Original CRISPR GACGCGGGCATATGAGGAGG CGG (reversed) Intronic
900139595 1:1134169-1134191 GACGCGGGCATGTGGGGAGGGGG - Intergenic
901919844 1:12528160-12528182 GCAGCGGGCATCTGAGGAAGGGG + Intergenic
903249641 1:22043450-22043472 GATGTGGGCATAAGTGGAGGAGG + Intergenic
905182725 1:36176794-36176816 GAGGCGGGCACGTGGGGAGGCGG - Exonic
907884088 1:58577181-58577203 GACGCGGGCGGATGAGGCGCGGG + Exonic
910978966 1:92939572-92939594 GAAGGGGGCATATGGGAAGGTGG - Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
915355191 1:155251598-155251620 GATGCTGGCAGATGAGGAAGAGG + Exonic
920541862 1:206784859-206784881 GACGCAGGCCTATGCCGAGGAGG + Intergenic
921613836 1:217243588-217243610 GACGTGGACAAAAGAGGAGGAGG - Intergenic
924093506 1:240526184-240526206 GACGTGGGCATCTTTGGAGGGGG + Intronic
1064612240 10:17115396-17115418 GCAGTGGGCATAGGAGGAGGAGG + Intronic
1067437289 10:46287157-46287179 GCCCCGGGCATAAGGGGAGGCGG + Exonic
1071499203 10:86191567-86191589 GACTCAGGCACAGGAGGAGGAGG + Intronic
1079229215 11:18634894-18634916 CACGCGTGCATCTGAGTAGGAGG - Intergenic
1083742366 11:64717620-64717642 GCCGTGGGAAAATGAGGAGGAGG - Intronic
1083826026 11:65204661-65204683 GCTGCGGGCAGGTGAGGAGGCGG - Exonic
1090331836 11:125938788-125938810 GACCCAGACATCTGAGGAGGGGG - Intergenic
1091232303 11:133996618-133996640 GACGAGGGCATGTGAAGACGGGG - Intergenic
1091397416 12:162590-162612 GAGGCAAGAATATGAGGAGGAGG - Intronic
1091482487 12:848034-848056 GAAGCGGGCAGATCACGAGGAGG - Intronic
1092937195 12:13375162-13375184 CATGTGGGCATATGCGGAGGTGG - Intronic
1093312621 12:17609071-17609093 GATGGGGGGATAAGAGGAGGGGG + Intergenic
1097046247 12:56189519-56189541 GAGGCGGGCGGAGGAGGAGGCGG - Exonic
1100502508 12:95187405-95187427 GAGGCGGGCAGATCATGAGGTGG + Intronic
1103604748 12:122078545-122078567 GACGCCGGGAGAGGAGGAGGTGG + Intergenic
1104269521 12:127270369-127270391 GAAGCGTGCATATGGGGATGAGG - Intergenic
1104982827 12:132581845-132581867 GGCGCGGGCATCGGGGGAGGGGG - Intronic
1108468299 13:50741277-50741299 AAAGCTGGCATTTGAGGAGGAGG - Intronic
1108922383 13:55692262-55692284 GACTTGGGCTTATGAGGAGCAGG + Intergenic
1111768075 13:92559858-92559880 GCTGTGGTCATATGAGGAGGCGG - Intronic
1113939434 13:114010726-114010748 GAGGGGGCCATGTGAGGAGGAGG + Intronic
1119932762 14:78564269-78564291 GAGGCGGGAATAGGAGGAGGGGG - Intronic
1122064203 14:99160237-99160259 GTGGCTGGCATGTGAGGAGGTGG - Intergenic
1123944618 15:25233039-25233061 GCCCAGGGCATATGGGGAGGAGG + Intergenic
1124753577 15:32388763-32388785 GAGGCCGGCACATGGGGAGGAGG - Intergenic
1125462325 15:39919577-39919599 GCCGGGGCCATCTGAGGAGGGGG + Intronic
1127088888 15:55447540-55447562 GAGGCGGGCAGATCAGGAGCTGG + Intronic
1129039087 15:72670410-72670432 GGAGCTGGCATATGAGGAGGAGG + Intergenic
1129210741 15:74066499-74066521 GGAGCTGGCATATGAGGAGGAGG - Intergenic
1129399599 15:75274260-75274282 GGAGCTGGCATATGAGGAGGAGG + Intronic
1129403270 15:75298830-75298852 GGAGCTGGCATATGAGGAGGAGG + Intergenic
1129476750 15:75790956-75790978 GGAGCTGGCATATGGGGAGGAGG + Intergenic
1129727937 15:77911115-77911137 GGAGCTGGCATATGAGGAGGAGG - Intergenic
1129839942 15:78737745-78737767 GGAGCTGGCATATGAGGAGGAGG + Intergenic
1130258935 15:82339202-82339224 GCAGCTGGCATATGAGGAAGAGG - Intergenic
1130269741 15:82439922-82439944 GCAGCTGGCATATGAGGAAGAGG + Intergenic
1130462082 15:84167220-84167242 GCAGCTGGCATATGAGGAAGAGG + Intergenic
1130473701 15:84246142-84246164 GCAGCTGGCATATGAGGAAGAGG + Intergenic
1130481116 15:84360206-84360228 GCAGCTGGCATATGAGGAAGAGG + Intergenic
1130490595 15:84427553-84427575 GCAGCTGGCATATGAGGAAGAGG - Intergenic
1130502183 15:84506323-84506345 GCAGCTGGCATATGAGGAAGAGG - Intergenic
1130595985 15:85250739-85250761 GCAGCTGGCATATGAGGAAGAGG + Intergenic
1131564079 15:93470139-93470161 CACGTGGGGATATGTGGAGGCGG - Intergenic
1132540209 16:504895-504917 GATGGGGGTATAGGAGGAGGTGG - Intronic
1132766374 16:1536385-1536407 GACGCAGGCAGGTGAGCAGGAGG - Intronic
1133280932 16:4664922-4664944 GTCCCGGGCAGGTGAGGAGGTGG + Intronic
1137223891 16:46482993-46483015 GAAGCAGGCCTCTGAGGAGGGGG - Intergenic
1137642045 16:50040594-50040616 GACCCAGGCATGCGAGGAGGTGG + Intergenic
1138817372 16:60217947-60217969 CACGTGGGGATATGTGGAGGTGG + Intergenic
1139465154 16:67150474-67150496 GCCGCGCGGAGATGAGGAGGAGG - Exonic
1140070661 16:71646944-71646966 GACACGTGCATATGAGCATGGGG + Exonic
1141378154 16:83550595-83550617 GCTGTGGGCACATGAGGAGGGGG + Intronic
1141508406 16:84496189-84496211 CACGTGGGGATATGTGGAGGCGG - Intronic
1143713846 17:8753295-8753317 GGTGGGGCCATATGAGGAGGTGG - Intronic
1145138165 17:20428725-20428747 GCCGAGGGCATATGCGGTGGGGG + Intergenic
1145204560 17:20976079-20976101 GAGGAGGACAGATGAGGAGGGGG - Intergenic
1147979941 17:44268185-44268207 GGGGCGGGCAGATTAGGAGGCGG - Intergenic
1149840936 17:59964572-59964594 GAAGCGGGCAGAGGAGGAGGCGG - Intronic
1150790759 17:68198920-68198942 GATGCCGGCGTATGTGGAGGGGG + Intergenic
1151396815 17:73828193-73828215 GACGAGGGCAGAAGGGGAGGAGG - Intergenic
1151829443 17:76540926-76540948 GGCGGGGGCAGAGGAGGAGGAGG - Intronic
1153156474 18:2155383-2155405 GCCTAGGGGATATGAGGAGGGGG - Intergenic
1153617153 18:6945695-6945717 GAAGCGGGAAGATGAAGAGGTGG + Intronic
1158615912 18:58987005-58987027 GGTGTGGGCATTTGAGGAGGAGG + Intergenic
1160522054 18:79513411-79513433 GACGCGGGTATCTGGGAAGGTGG - Intronic
1166316873 19:41994247-41994269 GACGCGGGCATATGAGGAGGCGG - Intronic
1167593147 19:50415112-50415134 GACCCCGGGATCTGAGGAGGAGG - Intronic
1168120101 19:54247239-54247261 GACGCCGACATTGGAGGAGGAGG + Intronic
1168253435 19:55154376-55154398 GGCTGGAGCATATGAGGAGGGGG - Intronic
1168286928 19:55339924-55339946 GGCGCGGGCGCCTGAGGAGGAGG + Exonic
925384624 2:3453498-3453520 GGCGAGGGCATAGGAGGAAGAGG - Intronic
928890442 2:36197658-36197680 GACGTGGACATATCTGGAGGTGG - Intergenic
931084582 2:58815187-58815209 GCCTGGGGCAAATGAGGAGGCGG + Intergenic
931514892 2:63044695-63044717 GAAGTGGGTAAATGAGGAGGCGG - Intronic
932312887 2:70758396-70758418 GGAGAGGGCATATAAGGAGGTGG + Intronic
935131462 2:100264346-100264368 CATGCGGGCCTCTGAGGAGGTGG - Intergenic
941162961 2:162055888-162055910 GAAGGAGGCATAGGAGGAGGGGG - Intronic
943593094 2:189822155-189822177 GGCGCGGGCAGTGGAGGAGGAGG + Intronic
1171810474 20:29742145-29742167 GGCGGGGGCGGATGAGGAGGGGG + Intergenic
1172888182 20:38245848-38245870 GAGGCGGGCAGAGAAGGAGGTGG - Intronic
1174413653 20:50352770-50352792 GATGAGGGCATATGGGGAGTAGG + Intergenic
1174528587 20:51193080-51193102 GACCCGGGCATGTGAAGAGATGG - Intergenic
1174736752 20:52972317-52972339 GTCGCGGGGAGAGGAGGAGGAGG + Intergenic
1179213728 21:39349106-39349128 GACGCGGGGGGAGGAGGAGGCGG - Exonic
1179493438 21:41756412-41756434 GACAAGGGCAGAAGAGGAGGTGG - Intronic
1181324091 22:22031479-22031501 GACACAGGCAGATGAGGAAGTGG + Intergenic
1182832860 22:33317799-33317821 GACTCGGGCATGTGGGGTGGGGG + Intronic
1185041915 22:48508462-48508484 AACGGCGCCATATGAGGAGGAGG + Intronic
1185272126 22:49934582-49934604 GTCACGGGCATATGAGGAGGAGG - Intergenic
950610021 3:14120519-14120541 GACGGTGGCATCTGAGCAGGAGG - Intronic
956196202 3:66655617-66655639 CACGCACGCATATGAAGAGGAGG + Intergenic
961521995 3:127472360-127472382 GAGGCAGGCAGAGGAGGAGGGGG + Intergenic
968434097 4:576164-576186 GACGCGGGAGGATGAGGAGGAGG - Intergenic
975550495 4:75608044-75608066 GAGGCGGGCAGATCACGAGGAGG - Intronic
982429450 4:155305808-155305830 CACGTGGGGATATGTGGAGGCGG + Intergenic
984361599 4:178741876-178741898 GAGGCGGGCAGATCACGAGGAGG + Intergenic
988738800 5:34049260-34049282 GACTCAGGCTTCTGAGGAGGGGG - Intronic
992925349 5:81579113-81579135 GATGCTGGCAGATGAAGAGGGGG + Intronic
997998184 5:138603331-138603353 GATGCTGGCAGATGAGGAGAGGG + Intergenic
998128429 5:139639147-139639169 GCAGTGGGCAGATGAGGAGGAGG + Intergenic
998352253 5:141509164-141509186 CAAGCCGGCATAAGAGGAGGAGG - Intronic
998836838 5:146210714-146210736 GAGGCGGGCAGATCACGAGGTGG + Intronic
999304581 5:150511456-150511478 GAGGCTGGCATTGGAGGAGGAGG + Intronic
1000807224 5:165810770-165810792 GAGGCGGGCATATCACGAGGAGG + Intergenic
1005479683 6:26243634-26243656 GATGCGGGCATCTGGGGGGGAGG - Intergenic
1006077966 6:31546493-31546515 GAAGCGGGCAGCTGAGAAGGTGG - Exonic
1008049052 6:46881304-46881326 GGCACTGGCATAAGAGGAGGAGG + Intronic
1015446985 6:133317839-133317861 GATGCGGGCATGGGAGGATGGGG - Intronic
1019954894 7:4405726-4405748 GAAGAGGGAAGATGAGGAGGAGG + Intergenic
1019954932 7:4405889-4405911 GAAGAGGGAAGATGAGGAGGAGG + Intergenic
1020680917 7:11235291-11235313 AATGCGGGCATTGGAGGAGGGGG + Intergenic
1021188311 7:17591426-17591448 GAAGCCAACATATGAGGAGGAGG - Intergenic
1025301160 7:57820659-57820681 GCCGCGGTCATAAGGGGAGGTGG - Intergenic
1032491704 7:132328862-132328884 GACCATTGCATATGAGGAGGGGG + Intronic
1032641313 7:133772077-133772099 GAAGGGGGAATATGAGGAGGGGG - Intronic
1049620013 8:143593828-143593850 GAAGCGGGGAAATGAGGAGGTGG - Intronic
1052937942 9:34109176-34109198 GGAGTGGGCCTATGAGGAGGTGG - Intronic
1054716222 9:68559995-68560017 GACTCAGGCCTTTGAGGAGGGGG + Intergenic
1058184829 9:101841939-101841961 AAATCGGGCATATCAGGAGGGGG - Intergenic
1061360422 9:130138458-130138480 GGCGAGGGCAGAGGAGGAGGGGG - Exonic
1061918549 9:133769753-133769775 GGCGAGGGCATGAGAGGAGGTGG - Intronic
1187443813 X:19343746-19343768 GCCGCGGGCGGGTGAGGAGGCGG - Intergenic
1198139516 X:133788724-133788746 GAGGAGGGCATAGGAGGAGGAGG - Intronic
1202367638 Y:24178001-24178023 GCAGCTGGCATATGAGGAAGAGG + Intergenic
1202377196 Y:24247934-24247956 GCAGCTGGCATATGAGGAAGAGG - Intergenic
1202493584 Y:25422187-25422209 GCAGCTGGCATATGAGGAAGAGG + Intergenic
1202503145 Y:25492122-25492144 GCAGCTGGCATATGAGGAAGAGG - Intergenic