ID: 1166317011

View in Genome Browser
Species Human (GRCh38)
Location 19:41994674-41994696
Sequence CTGCAGGAGGGGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 508}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166316993_1166317011 26 Left 1166316993 19:41994625-41994647 CCAGGGACCCTGGAGACGGCGGG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG 0: 1
1: 0
2: 5
3: 48
4: 508
1166316998_1166317011 19 Left 1166316998 19:41994632-41994654 CCCTGGAGACGGCGGGGGGTAGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG 0: 1
1: 0
2: 5
3: 48
4: 508
1166316999_1166317011 18 Left 1166316999 19:41994633-41994655 CCTGGAGACGGCGGGGGGTAGTG 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG 0: 1
1: 0
2: 5
3: 48
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166317011 Original CRISPR CTGCAGGAGGGGAAGTTGGA AGG Intronic
900520030 1:3100970-3100992 CTGGAGGAGGGGGCATTGGAGGG + Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
901842823 1:11964585-11964607 CTGGTGGTGGGGAAGATGGAGGG - Intronic
901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG + Intronic
902668236 1:17954135-17954157 GAGGAGGAGGGGAAGTTAGAAGG + Intergenic
902814395 1:18907960-18907982 CTGAAGGAGAGAAAGGTGGAAGG - Exonic
902903313 1:19535272-19535294 GGGCAGGAGGGGAGCTTGGAGGG - Intergenic
902976462 1:20092198-20092220 CTGCAGGAGGGGGTGTGGGCAGG + Intergenic
902987867 1:20166411-20166433 AGGCAGGAGGGGGAGTGGGAGGG - Intronic
903031453 1:20466904-20466926 CTTCAGGAGGGACAGCTGGATGG - Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903630600 1:24766747-24766769 CTTCAGGAGGGCAAGGTGGGCGG - Intronic
903808231 1:26020556-26020578 CTGCAGGATGAGGAGTTGGCTGG + Intronic
903886322 1:26543041-26543063 CTGCAGAGGGGGAAGTGAGAAGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904320985 1:29697691-29697713 CTGCAGGAGGGGAGGTGAGGTGG + Intergenic
904695994 1:32331886-32331908 CTACAGGTGGGGAGCTTGGAGGG - Intronic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
905028651 1:34867192-34867214 CTGCAACAGAGGAAGATGGAGGG + Intronic
905405263 1:37728233-37728255 CTGGAGGGTGGGAAGATGGAGGG + Intronic
905792708 1:40798841-40798863 ATGCAGGAGGGCAAGTGGCAAGG - Intronic
905862054 1:41358347-41358369 CTGGAGGAGGGGAAGTGACAGGG + Intergenic
906298358 1:44662870-44662892 CAGGAGGAGGGGCAGTTGGGAGG - Intronic
907205811 1:52770036-52770058 CTGCAGGAGGGGGAGTGTGGGGG + Intronic
907461031 1:54605607-54605629 CTGCTGGGGGTGGAGTTGGAAGG + Intronic
907883764 1:58575187-58575209 CTGCAGGAGGGTGAGCTTGAGGG - Intergenic
907928896 1:58980627-58980649 CAGCAGGAGGGGAAGTGTGATGG - Intergenic
907958899 1:59259971-59259993 AAGCAGTAGTGGAAGTTGGAGGG - Intergenic
908779300 1:67674748-67674770 GGGCAGTAGGGGAAGTGGGAGGG + Intergenic
909514829 1:76495619-76495641 CTTTAGGAAGGGGAGTTGGAGGG - Intronic
909562980 1:77025781-77025803 CTGGAGGAGGGGCAGCAGGAGGG - Intronic
909800896 1:79806192-79806214 CTGGAAGAGGGGAATATGGAGGG + Intergenic
910208986 1:84774967-84774989 ATGAAGGAGAGGAAGATGGATGG - Intergenic
911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG + Intergenic
912311192 1:108622989-108623011 CTTCAGGAGGTCAAGGTGGAAGG + Intronic
912752515 1:112297522-112297544 CTGCAGGCTGGGAAGTTCAAGGG + Intergenic
913098138 1:115539138-115539160 CTGCAGGCGAGGAGGTGGGAGGG + Intergenic
914302568 1:146389396-146389418 CTGCAGGAGGGGAAGTACTCAGG + Intergenic
914517174 1:148383978-148384000 CTGCAGGAGGGGAAGTACTCAGG - Intergenic
914995061 1:152536227-152536249 CTGGAGGAGAGGAAGTTGCTGGG + Intronic
915145058 1:153791963-153791985 CAGCAGCAGGGGAAGCTGGCCGG + Intergenic
915297481 1:154931368-154931390 CTTCAGAAAGGGAACTTGGAAGG - Intronic
916031594 1:160881872-160881894 CTGCAGGAGGGATGGCTGGAAGG - Intronic
916039619 1:160950958-160950980 CTGCAGGAGGGAGGGCTGGAAGG - Intronic
917815521 1:178706124-178706146 CTGAAGGAGTGGAAGTTTGATGG + Intergenic
918047330 1:180949408-180949430 CAGCTGGAGGGGAATTTGAAAGG + Exonic
919690946 1:200527926-200527948 CTTCAGGAGGGGCAGTAGAAAGG - Intergenic
919843818 1:201628578-201628600 AGGCAGGAGGGGAAATTGAAGGG - Intronic
919914451 1:202130892-202130914 CAGCAGGAGGGAGAGGTGGAGGG - Exonic
920335813 1:205244465-205244487 GAGCAGGAGGGGAGGTGGGAAGG + Intronic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
922494434 1:226044928-226044950 CTGCAGGCTGGGAAGTTCAAGGG - Intergenic
923045855 1:230355181-230355203 CTGCAGGTGGGCAAGTAGGCAGG - Intronic
924101109 1:240603514-240603536 GTGCTGGAGGGGGAGATGGATGG - Intronic
924542939 1:244998452-244998474 CTTCAGGAGGCCAAGGTGGAAGG - Intronic
924577450 1:245293310-245293332 CTGCAGGAGGGGGTGGTTGACGG + Intronic
1062917279 10:1250636-1250658 CTGCAGGCTGGGAAGTTTAAGGG - Intronic
1063420273 10:5906918-5906940 CTCCAGGTGGGGAAGGTGGGAGG - Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064920327 10:20509640-20509662 CTGCAGGCTGGGAAGTTCAAGGG - Intergenic
1065225080 10:23535398-23535420 CTGCAGGAGGCCAAGGTGGTAGG - Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065495385 10:26322083-26322105 CTTCAGGAGTAGAAGATGGATGG + Intergenic
1065692313 10:28347226-28347248 CTGCAGGCTGGGAAGTTCAAGGG + Intergenic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066265759 10:33774385-33774407 CTGCAGATGGGGAAGCCGGAAGG - Intergenic
1067056203 10:43053100-43053122 CTAGAGGAGAGGAAGGTGGAGGG - Intergenic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1068446070 10:57125357-57125379 CTGCAGGCTGGGAAGTTCGAGGG - Intergenic
1068864554 10:61881333-61881355 CTTCAGGAGGGCAAGGTGGGTGG + Intergenic
1069230960 10:66007854-66007876 AGGAAGGAGGGGAAGTAGGAAGG - Intronic
1070844158 10:79508151-79508173 CTGGAGGAGGGAAAGGTGCAAGG - Intergenic
1070929639 10:80252160-80252182 CTGGAGGAGGGAAAGGTGCAAGG + Intergenic
1071294437 10:84209007-84209029 CTGCAGGAGGGGCAGAGGGCTGG - Intronic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073260780 10:102188706-102188728 GTGCAGGAAGGGAAGTTGAGAGG - Intergenic
1073686048 10:105755033-105755055 TAGCAGGGGTGGAAGTTGGAGGG - Intergenic
1074025005 10:109625412-109625434 CTGAAGGAGGGGGATCTGGATGG - Intergenic
1074247459 10:111709269-111709291 CTTCTGGAGGGGGATTTGGAAGG + Intergenic
1074384596 10:113006903-113006925 GTGCAGGACTGGAAGTGGGAAGG - Intronic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074546931 10:114408478-114408500 CTGCAGGTTGGGGAGTTGAAGGG + Intergenic
1074614745 10:115056395-115056417 GTGGAGGAGAGGAAGTGGGAGGG - Intergenic
1075444052 10:122501525-122501547 CAGCAGGGAAGGAAGTTGGAGGG - Intronic
1076692435 10:132230660-132230682 CTGCTGGGGGGGAAGCTGGCGGG + Intronic
1077024912 11:434812-434834 CCGGAGGAGGGGAATTTGCAGGG + Intronic
1077104688 11:837094-837116 CGGCATGAGGGGAGGTTGGGTGG - Intronic
1078156632 11:8805556-8805578 CTGAAGGACTGGAAGTAGGAGGG - Intronic
1078741214 11:14067812-14067834 CTGCAAGTGGGGAAGATGGAGGG + Intronic
1079141587 11:17814063-17814085 AGGGAGGAAGGGAAGTTGGAAGG + Intronic
1079426817 11:20351404-20351426 CTGCAGGACGGGGAATGGGAAGG + Intergenic
1080222501 11:29922310-29922332 GGGCAGGAGGGGAAGTGGCAAGG - Intergenic
1080857184 11:36122322-36122344 GTGCAGGGGGAGAAGTGGGAAGG + Intronic
1080937864 11:36882489-36882511 TTGCAGGAGGGGCAGTGGGCCGG - Intergenic
1081952723 11:47059205-47059227 GTGAAGGAAGGGAAGTTAGAGGG + Intronic
1082032461 11:47615406-47615428 CTGAAGGAGGGAGAGTTTGAAGG + Intergenic
1082627803 11:55504822-55504844 CTAGAAGAGGGAAAGTTGGAAGG + Intergenic
1083133463 11:60648654-60648676 CTAAAGGGGAGGAAGTTGGAAGG + Intergenic
1083203397 11:61133184-61133206 CTGCAGCAGGGGCCCTTGGAAGG - Intronic
1083887858 11:65581507-65581529 GAGCAGGAGGGGGAGTTGGGGGG - Intronic
1084412633 11:69013288-69013310 CGGCAGGAGGGGGAGGGGGAGGG + Exonic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1089017182 11:115175529-115175551 CCACAGGAGGGGAAGTAGGGAGG - Exonic
1089196148 11:116695002-116695024 CTGCAGGACGGGAAGCATGAGGG - Intergenic
1089301444 11:117501518-117501540 CAGCAGGAGGGGAAGAGGCAGGG - Intronic
1089840664 11:121414571-121414593 CTGCAGGAGAGGTACATGGAGGG - Intergenic
1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG + Intronic
1092039398 12:5370703-5370725 CTGCTGGAGGGGAAGCTTGGGGG - Intergenic
1092134478 12:6136956-6136978 CTGCAGGAGGGGGACATGGAAGG - Intergenic
1092382915 12:8012530-8012552 CTGCAGTAGGGGGAGTTGGGTGG + Intergenic
1093478513 12:19581204-19581226 CTGCAGGCTGGGAAGTTCAAGGG - Intronic
1093598524 12:20992042-20992064 CTGCAGACAAGGAAGTTGGAGGG - Intergenic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096572495 12:52531693-52531715 CTCCAGGAAGGGGAGGTGGAAGG - Intergenic
1097119577 12:56721040-56721062 CTGAAGGAGGTGAAGTAAGAAGG + Exonic
1100252883 12:92848270-92848292 TTGCAGGAGGAGACGATGGAGGG + Intronic
1100503306 12:95195223-95195245 CTGCTGGAGGGGATGTTGTCAGG - Intronic
1100582675 12:95949980-95950002 GTGCAGGAGGTGAATTTTGAGGG - Intronic
1101088528 12:101260673-101260695 CTGCAGGATTCTAAGTTGGATGG - Intergenic
1101397629 12:104362474-104362496 CCGCAGTGGGGGAGGTTGGAAGG - Intergenic
1101829522 12:108246510-108246532 GTGCAGAAGGGGAACCTGGATGG - Intronic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102295036 12:111729905-111729927 CTGCTGACGGGGAAGATGGAGGG - Exonic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102564059 12:113783116-113783138 CTGCAGGAGGAGAAGTGGAGAGG - Intergenic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103614279 12:122142271-122142293 CTGCCCGTGGGGCAGTTGGAAGG + Exonic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1104287171 12:127433909-127433931 CTGGGGGTGGGGACGTTGGAAGG - Intergenic
1104644698 12:130488695-130488717 CCTCAGGATGGGAAGTGGGAGGG - Intronic
1106434266 13:29709845-29709867 CTGCAGGAGGCTTAATTGGACGG + Intergenic
1106449990 13:29872331-29872353 CTGCAGGGGGGCAATTTGGCTGG - Intergenic
1107521552 13:41187244-41187266 CATCAGGATGGGATGTTGGAAGG - Intergenic
1107523507 13:41206322-41206344 CTGCAGGCTGGAAAGTTGAAGGG - Intergenic
1107749178 13:43545901-43545923 GTGCAGGGGAGGATGTTGGAGGG + Intronic
1110911213 13:80966412-80966434 TTTCAGGAGCAGAAGTTGGATGG + Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1112004342 13:95241517-95241539 CTGCAGGGGGGGCAGGAGGAAGG - Intronic
1112953515 13:105031716-105031738 CTGAAGCAGAGGAAGTTAGATGG + Intergenic
1113575694 13:111393870-111393892 GGGCAGGAGTGGAAGCTGGAGGG - Intergenic
1114487575 14:23072060-23072082 CTGCAGGTAGGGAGGTGGGATGG + Intronic
1116752882 14:48909102-48909124 CTGAAGGAGGGGAAGAAAGAAGG - Intergenic
1117328709 14:54691705-54691727 CGGCTGGAGGGGAAGCAGGAAGG + Intronic
1117394078 14:55291588-55291610 CTTCAGGAGGTGAAGTGGGGAGG + Intronic
1117483632 14:56172545-56172567 CTTAAGGAGGGGAGGTTGGTTGG + Intronic
1118301214 14:64618124-64618146 CAGGAAGAGGGGAAGTTGAAGGG - Intergenic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119364148 14:74077434-74077456 CTGCAGGCTGGGAAGTTCAAGGG + Intronic
1119386374 14:74260224-74260246 GGGCAGGTGGGGAAGTTGGCAGG - Intronic
1119669834 14:76510008-76510030 CTGCAGGATGGGGAATGGGAAGG + Intergenic
1119770822 14:77219717-77219739 CTGCAGGAAGGGGACTTGGAGGG + Intronic
1120140007 14:80919463-80919485 GTGAAGGAGGGGTGGTTGGAAGG - Intronic
1120255222 14:82110101-82110123 CTCCAGGAGGGGAAGGGAGAGGG + Intergenic
1121145601 14:91579473-91579495 CGGCAGGAAGGGGAGTTGGAAGG - Intergenic
1121523768 14:94604199-94604221 CTCCAGGAAGGGGAGTAGGAAGG - Intronic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1122565849 14:102655245-102655267 CTCCAGGAAGGGAAAATGGAAGG - Intronic
1122789921 14:104179829-104179851 CTGGAGGACGGGACGTGGGACGG + Intronic
1123002969 14:105306231-105306253 CTCCAGGAGGGGAAGTTTGCAGG - Exonic
1123701397 15:22917163-22917185 CTGCAGGAGGGTCAGGGGGACGG - Intronic
1125104611 15:35955939-35955961 CTGCTGGAGGATAAATTGGAAGG - Intergenic
1125152113 15:36544741-36544763 CTGCAAGAGGGGCATGTGGAAGG + Intergenic
1125676733 15:41506006-41506028 CTGCAGGAAGACACGTTGGAAGG + Intronic
1126399344 15:48253350-48253372 CTGCCTGAGGCTAAGTTGGAGGG - Intronic
1126825648 15:52545371-52545393 CTTCAGGAGGCCAAGGTGGATGG - Intergenic
1127868253 15:63048773-63048795 CTGCGGGGGGGGAAGCAGGAGGG - Intronic
1129069582 15:72939575-72939597 TTGCAGAGGGGAAAGTTGGAGGG - Intergenic
1129689877 15:77707126-77707148 CTGCAGGCAGGGATGCTGGAGGG + Intronic
1131315190 15:91329444-91329466 CACCAGGTGGGGAAGCTGGAGGG - Intergenic
1131369461 15:91867669-91867691 GAACAGGAGGGGAAGTTTGAAGG - Intronic
1132303052 15:100788263-100788285 CTGCTGCAGGGGAAGTAGCAGGG - Intergenic
1132344361 15:101099422-101099444 CTGCAGGAGGTGCCGGTGGAAGG - Intergenic
1132573578 16:654853-654875 CTTCAGGATGAGAAGATGGAGGG + Intronic
1133171474 16:3984921-3984943 GGGCAGGAGGGGCACTTGGACGG + Intronic
1133414836 16:5598289-5598311 TTGCTGGAGTGGAAGGTGGAAGG + Intergenic
1134253001 16:12587896-12587918 AGGCAGGAGGGGAATGTGGAGGG - Intergenic
1134598384 16:15514025-15514047 CTTCAGGAGGCCAAGTTGGGAGG + Intronic
1134839845 16:17393030-17393052 GGGCAGGAGGGGAAGGAGGAAGG - Intronic
1135420867 16:22304755-22304777 GTCCAGGAGGGGCAGGTGGAGGG + Intronic
1135819902 16:25674646-25674668 CTGCAGGCTGGGAAGTTCAAGGG - Intergenic
1135976020 16:27109439-27109461 AGGAAGGAGGGGAAGTTGGAGGG + Intergenic
1136231810 16:28890209-28890231 CTTCAGGAGGCCAAGGTGGAAGG + Intronic
1136367220 16:29814345-29814367 CTGCAGCAGGGGGACGTGGACGG + Exonic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1137366314 16:47862670-47862692 CTGCAGGAGGTGATGGTGGCTGG + Intergenic
1137806602 16:51312360-51312382 TGGCAGGAAGGGCAGTTGGAAGG - Intergenic
1137817391 16:51411439-51411461 CTGGAGGAGGGGTATTTGCATGG + Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138328679 16:56194679-56194701 GCGCAGGAGGGGAAGGAGGAGGG + Intronic
1139066777 16:63325404-63325426 GAGGAGGAGGGGAAGTTGGCAGG + Intergenic
1139485859 16:67256249-67256271 CTCCTGGAAGGGAAGGTGGAAGG - Intronic
1139621180 16:68144586-68144608 CTTTAGGAGGGCAAGGTGGATGG - Intronic
1141318584 16:82985261-82985283 CTAAAGGAGGGGGAGTTGAAAGG + Intronic
1141710657 16:85697105-85697127 CTCCAGGAAGGGAGGTTGGGAGG - Intronic
1142020465 16:87779115-87779137 CTGCAGGCCGGGAAGTTGGCAGG - Intergenic
1142372661 16:89691714-89691736 CTGCAGGAGGGGACATGGGCAGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1143070991 17:4293137-4293159 CTGCTGGAGGGGAGGTGGGGGGG - Intronic
1143288893 17:5813683-5813705 CAGCTGGAGGAGCAGTTGGAAGG - Intronic
1143742007 17:8961243-8961265 CTACAGGAGAGGAAGAAGGAGGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1145065669 17:19759796-19759818 CTGCTGGAGGAGAAGCGGGAAGG + Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146555137 17:33816719-33816741 CTGCAGGAGGGAGGGCTGGAGGG - Intronic
1146584213 17:34068440-34068462 CTGCAGAATGGGCTGTTGGAAGG - Intronic
1147125435 17:38364810-38364832 GAGGAGGAGGGGGAGTTGGAGGG - Exonic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147843595 17:43389569-43389591 CTGCAGGATGGAAAGCCGGATGG + Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148537772 17:48455169-48455191 CAGCAGGATGGGGAGCTGGAAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1149048048 17:52270432-52270454 CTGCAGGAGGAGGAGTTGGGTGG + Intergenic
1149790993 17:59477039-59477061 CTTCAGGAGGCCAAGGTGGAAGG - Intergenic
1149998364 17:61416732-61416754 CTCCAGGAGGGGAAGGGGGCAGG - Intergenic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151488535 17:74417819-74417841 CTGCAGGAGGGGTGTTAGGAAGG + Intergenic
1151717742 17:75840051-75840073 CTGCAGGAGGTGGAGGTGCACGG + Exonic
1151848056 17:76671781-76671803 CTTGAGGTGGGGAAGATGGAAGG + Intergenic
1152286475 17:79415913-79415935 CTGCAGGTGAGGAGGTGGGAGGG - Intronic
1152589724 17:81205484-81205506 CAGCGGGAGGGGAGGTAGGAGGG + Intronic
1152603020 17:81274596-81274618 AGGCAGGAGGGGAACCTGGACGG + Intronic
1152628763 17:81400193-81400215 CTGCAGGAGGGGGCGGGGGAGGG - Intronic
1152832339 17:82505488-82505510 CTGCAGGCTGGGAAGTTCAAGGG + Intergenic
1153667276 18:7377308-7377330 TTTCAGGAGAGGATGTTGGAGGG - Intergenic
1153934196 18:9906115-9906137 CTACAGGAGAAGGAGTTGGAGGG + Intergenic
1154268015 18:12895800-12895822 CTCCAGGAGGCCAAGTTGGGAGG - Intronic
1156624258 18:38889395-38889417 CAGTAGGAAGGGAAGTTGGATGG - Intergenic
1156876466 18:42019913-42019935 CTGGTGGAGAGGAAGTAGGAAGG - Intronic
1157404455 18:47411329-47411351 CTGGAGGAGGTGAAGTGGGAAGG + Intergenic
1157605716 18:48924712-48924734 CTGCTGGTGGGGGAGCTGGAGGG - Intronic
1159361143 18:67404702-67404724 CGGGAGGAGAGGAAGTGGGAAGG - Intergenic
1160057031 18:75492680-75492702 TTGCAGGAGGTGGCGTTGGAAGG - Intergenic
1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1161155650 19:2730935-2730957 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG + Intronic
1161911137 19:7195017-7195039 CTGCAGGAGGGGATGCTGCTGGG - Intronic
1162479170 19:10918628-10918650 GTGCAGGAGGGCAAGGTGGGCGG - Intronic
1162790079 19:13058154-13058176 AAGCAGGAGGGGTGGTTGGATGG + Intronic
1163273289 19:16266971-16266993 CTGGAGGAAGGGATGCTGGAAGG + Intergenic
1163303914 19:16465256-16465278 CTGCAGGAGGGGCAGATGACTGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1165742215 19:38211133-38211155 CTGCAGGTGGGGGAGGTGGTGGG - Intronic
1166232456 19:41433192-41433214 ATGCAGGAGAGGAAGTGGGGAGG - Intronic
1166248850 19:41551682-41551704 CTTCAGGAGGGGAAGCTTCAGGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166671902 19:44715265-44715287 CAGCAGGAGGGGCAGAAGGAGGG + Intergenic
1167096327 19:47376681-47376703 CCACAGGAGGGGAAGTTCCAGGG + Intronic
1167145559 19:47679553-47679575 CTGCAGGGTGGGCAGCTGGAAGG - Exonic
1168192483 19:54749651-54749673 CTGCAGGAGGCCAAGGTGGGTGG + Intronic
1168196813 19:54780928-54780950 CTGCAGGAGGCCAAGGTGGGTGG + Intronic
926625095 2:15084619-15084641 CTCCAGAAGTGGAAGATGGAAGG - Intergenic
927052037 2:19339281-19339303 CTGCAGGAGGGTGGGTTGGGGGG + Intergenic
927228549 2:20796336-20796358 CTCCAGGTGGGGAAGTGGGTGGG + Intronic
927271904 2:21220108-21220130 CTGGAGGGAGGGAAGTGGGAGGG - Intergenic
927528040 2:23766604-23766626 CTGCACCAGGGAAAGCTGGATGG + Intronic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
928136733 2:28693512-28693534 GTGCTGGGGGGGAAGTTGGAGGG - Intergenic
929260304 2:39859528-39859550 CTCCAGGAAGGGAAGACGGAAGG - Intergenic
930122956 2:47774823-47774845 CTGTAGTAGGAGAAGTTGAAGGG + Intronic
930163693 2:48183093-48183115 TAACAGGAGGTGAAGTTGGAGGG - Intergenic
931431134 2:62209790-62209812 CTGCAGGCTGTGATGTTGGAGGG + Intronic
931692737 2:64849120-64849142 CTGCAGGCTGAAAAGTTGGATGG - Intergenic
932709440 2:74051148-74051170 TTGCAGGATGGGATGTTGCAAGG + Intronic
933641840 2:84770737-84770759 CTGTAGGAGGCCAAGGTGGAAGG + Intronic
934733406 2:96673638-96673660 CGGCTGGAGGGGTAGTTGGTTGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
935949674 2:108317265-108317287 CTGCAGGGGTGGAAGTGGCAGGG - Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937219436 2:120333308-120333330 CTGCTGAAGAGGTAGTTGGATGG - Intergenic
937615758 2:123920541-123920563 CTGCAGGCTGGGAAGTTCGAGGG + Intergenic
937700377 2:124857171-124857193 CTGCACGAGTTGAAGTGGGAGGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938055735 2:128213400-128213422 CCGTAGGAGGGGAAGTGGGGAGG - Intergenic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
940444821 2:153765089-153765111 GTGCAGAAGGGAAAGTGGGATGG + Intergenic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942468060 2:176229787-176229809 CTGCAGGTTGGGAAGTTCAAGGG + Intergenic
943328940 2:186535860-186535882 CTGCAGGAGGGGGAGTTTAAGGG + Intergenic
943732303 2:191315207-191315229 AGGGAGGAGGGGAAGATGGATGG - Intronic
945019572 2:205557440-205557462 CTGCAGGAGCAGAAGTTGAGGGG - Intronic
946262352 2:218504828-218504850 CTTCAGGAGGCCAAGTTGGAGGG - Intronic
946390696 2:219415082-219415104 TGGGAGGAGGGGAAGGTGGAGGG + Intergenic
946438489 2:219675517-219675539 TTGCTGGAGGGTAATTTGGAGGG + Intergenic
946687946 2:222290763-222290785 CTGCTGGAGGGGGAGAAGGAGGG + Intronic
948935500 2:241161713-241161735 GTGCTGGAGGGGAACTTGGGAGG + Intronic
1169022476 20:2340242-2340264 CTTCAGCAGGGGAAGCAGGAGGG - Intronic
1169423467 20:5477923-5477945 CTGCAGGAGCGGGAGTGGCAGGG - Intergenic
1169424745 20:5487075-5487097 CTGCAGGAGGGGGAATGGCAGGG - Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1172435443 20:34925935-34925957 CTAGAGTAGGGGAACTTGGATGG + Intronic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1173312851 20:41916126-41916148 CTGCGGGTGGGGAAGTTAGGTGG + Intergenic
1173796147 20:45861525-45861547 CAGCAGGAAAGGAAATTGGAGGG + Intronic
1173846589 20:46192541-46192563 CTGCAAGAGTGGGAGTGGGAAGG + Intronic
1174505316 20:51013998-51014020 CTGCTGGAGGGAAAGCTGGGAGG - Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174539326 20:51276595-51276617 CTGCATGATGGGAACTTTGAGGG + Intergenic
1174568035 20:51481075-51481097 TTGTAGGAGGGGAGGATGGAGGG - Intronic
1175121903 20:56722284-56722306 CTGCAGGAGGGAAAAGAGGAAGG + Intergenic
1175598971 20:60257379-60257401 TTGGAGGAGGGGAAGATGGGAGG - Intergenic
1175621934 20:60454718-60454740 CTCCAGGAGTGGAAGTAGGTGGG - Intergenic
1175855432 20:62118474-62118496 AGGCAGGAGGGGGAGATGGATGG + Intergenic
1176047547 20:63100684-63100706 ATGCAGGAGGGGAGGCTGCAGGG - Intergenic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1176293402 21:5058335-5058357 CTGCAGGGGTGGAGGTTGCAGGG - Intergenic
1176376867 21:6091182-6091204 CTGCGGGAGGGGAAGATGCTGGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178524910 21:33319443-33319465 CTGCAGGAGGTGGGGTGGGAGGG + Intergenic
1179013345 21:37573874-37573896 CCGCAGGAGGGGGAGTGGGAAGG + Intergenic
1179746608 21:43447062-43447084 CTGCGGGAGGGGAAGATGCTGGG + Intergenic
1179863858 21:44205313-44205335 CTGCAGGGGTGGAGGTTGCAGGG + Intergenic
1180020980 21:45126850-45126872 CTGCAGGATGGGAAACTGCATGG - Intronic
1180072870 21:45445554-45445576 CTGCAGGAAGGGACGTGAGATGG - Intronic
1180716458 22:17875859-17875881 CTGCAGGAAGGGCAGGGGGATGG + Intronic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181267753 22:21640918-21640940 CTGGGGGAGGGGTAGTTTGAGGG + Intergenic
1181973764 22:26713704-26713726 ATGCAGGAGGGTTGGTTGGAAGG + Intergenic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182693211 22:32177755-32177777 CTCCAGGAAGGGAAGAAGGAAGG + Intergenic
1182874801 22:33682390-33682412 GTGCAGGAGAAGAAGTGGGAAGG - Intronic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183266935 22:36833631-36833653 CTGCCAGGGGTGAAGTTGGAGGG + Intergenic
1183738504 22:39657135-39657157 GGGCAGTGGGGGAAGTTGGAGGG - Intronic
1185239449 22:49734918-49734940 CTGCAGGAGGGTGAGTGGGAGGG - Intergenic
1185303231 22:50095188-50095210 GTGCAGGTGGGGAACGTGGAGGG - Intronic
949157357 3:845551-845573 CTGCTGCAGGGGCAGTGGGAGGG - Intergenic
949160885 3:880527-880549 CTGCAGCTGGGGCAGTTAGACGG + Intergenic
949181051 3:1131842-1131864 CTGCGGGATGGAAAGTTTGAAGG + Intronic
949948444 3:9208700-9208722 CTTCAGGAAGGGAGGATGGAGGG + Intronic
949965698 3:9354308-9354330 CTGCAGGAGAGGAAGAAGGTGGG + Intronic
950107537 3:10397774-10397796 CTGCAGGTGGGGATGTTGGAGGG - Intronic
950202717 3:11056499-11056521 CTGCAGGAGGGGTTGTGGGAGGG + Intergenic
950439474 3:13000734-13000756 CTGAAGGAGGGCCAGTTGGTGGG + Intronic
950440416 3:13007126-13007148 GTGCAGGAGAGGAAGCTGGCAGG + Intronic
952080489 3:29752139-29752161 CAGCAGGAAGGGGAGCTGGAAGG + Intronic
952261126 3:31741504-31741526 CTTCAGGAGGCCAAGGTGGATGG - Intronic
952336964 3:32411919-32411941 AGGCAGGAGGGAAAGGTGGAAGG + Intronic
953041436 3:39258050-39258072 ATGCAGGAGGGGAAGGTTAAAGG + Intergenic
953165471 3:40460951-40460973 CTTCAGGAGGCCAAGGTGGAGGG + Intronic
953837208 3:46357060-46357082 GAGCAGGAGGGGCAGGTGGAGGG + Intronic
954240638 3:49290868-49290890 CTTCACGAGGGCAAGGTGGAAGG + Intronic
955232351 3:57110257-57110279 CTGGAGGAGCTGAAGTCGGAGGG - Exonic
956447648 3:69341485-69341507 CTGCAGGAGTGGAGGTGGCAAGG + Intronic
959784810 3:110283244-110283266 CTGCAGCAGGGGTAGAGGGAAGG - Intergenic
960101267 3:113745942-113745964 CAGCAGGCGGGGAAGATGAAAGG - Exonic
960129744 3:114043309-114043331 CAGCAGGAGATGAGGTTGGAGGG + Intronic
962086631 3:132198351-132198373 CTTCAGTAGGGGAAGTGGGAAGG - Intronic
962108189 3:132415520-132415542 CTGTAGCAGGGGTAGTTAGAAGG + Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962490750 3:135891790-135891812 GTGCATGAGGGGAAGATGGGTGG - Intergenic
962872515 3:139509932-139509954 CTCCTGGAAGGGAAGATGGAGGG - Intergenic
963356803 3:144218144-144218166 CTGGAGCAGGGGAAGTTTGGTGG + Intergenic
964626914 3:158768504-158768526 CTGCCGGCAGGGAAGTGGGAGGG - Intronic
965834934 3:172841015-172841037 CTCCAGGAGGGGGAGGGGGAGGG - Intergenic
967420368 3:189265707-189265729 CAGAAGGAGGGGGAGTAGGAAGG - Intronic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
968135123 3:196215342-196215364 TAGGAGGAGGGGAAGCTGGAGGG + Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968933993 4:3600482-3600504 GTGCAGGAGGGGAACTAGGCTGG - Intergenic
969308868 4:6340594-6340616 GTGCAGGTGGGGAAGGTGGTGGG - Intronic
969566538 4:7982074-7982096 CTGCTGGGGAGGGAGTTGGAGGG - Intronic
969566553 4:7982132-7982154 CTGCTGGGGAGGGAGTTGGAGGG - Intronic
971515903 4:27486039-27486061 CTGCAGGACTGGGAGATGGATGG + Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972510219 4:39762303-39762325 CTTCAGGAGGCCAAGGTGGAAGG - Intronic
973779436 4:54274410-54274432 CTGCTGGTGGGGAAGTGTGAGGG - Intronic
974260513 4:59518902-59518924 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260535 4:59518966-59518988 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260557 4:59519030-59519052 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260579 4:59519094-59519116 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260583 4:59519106-59519128 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260587 4:59519118-59519140 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260600 4:59519156-59519178 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260613 4:59519194-59519216 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260626 4:59519232-59519254 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260630 4:59519244-59519266 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260634 4:59519256-59519278 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260647 4:59519294-59519316 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260660 4:59519332-59519354 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260673 4:59519370-59519392 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260677 4:59519382-59519404 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260681 4:59519394-59519416 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260694 4:59519432-59519454 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260698 4:59519444-59519466 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260702 4:59519456-59519478 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
974260706 4:59519468-59519490 CTGCAGGAGGGGCTGCAGGAGGG - Intergenic
975765912 4:77667401-77667423 CTGCAGGAGTGGAGACTGGAAGG - Intergenic
977044821 4:92055996-92056018 CTGTAGGAGGCCAAGGTGGACGG + Intergenic
977559385 4:98516943-98516965 CTGCAGGCTGGGAAGTTCAAGGG - Intronic
977686925 4:99857296-99857318 CTGCAGGAGGGGTGGGTTGAGGG + Intronic
978439373 4:108717427-108717449 CTGCAGGAGGGGAAATGTGGAGG - Intergenic
978905060 4:113995748-113995770 CTTCAGGAGGCCAAGTTGGGAGG - Intergenic
979580186 4:122349262-122349284 CTAAAGGAGGAGTAGTTGGAGGG + Exonic
980786699 4:137565228-137565250 CTGCAGGAGGTGGTCTTGGAAGG + Intergenic
981932117 4:150201323-150201345 CGGCAGCAGCGGAAGTTGCAGGG + Intronic
982676255 4:158379714-158379736 CTGCAGGCTGGGAAGTTCAAGGG - Intronic
982870361 4:160572414-160572436 CTGCAAATGGGGAAGTTTGAGGG + Intergenic
983296213 4:165872599-165872621 GCGCAGGAAGGGAAGCTGGATGG - Intergenic
983989410 4:174099330-174099352 CTGAAGGGGGGAAAGTAGGATGG + Intergenic
985393360 4:189514913-189514935 CTGCAGGAGGGGGGGGGGGATGG - Intergenic
985658538 5:1144198-1144220 CTCAGGGAGGGGAAGTTGGCCGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986127791 5:4899439-4899461 CTGCAGGCAGGGAAGTCAGAAGG - Intergenic
987043216 5:14082668-14082690 CTGCGGGAGATGAAGTAGGATGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
990269999 5:54126768-54126790 CTGGAGGCTGGGAAGTTCGAAGG - Intronic
990954804 5:61331547-61331569 CGGCTGGAGGGGAAGCTGGCAGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991576884 5:68113792-68113814 CTGCAGGTTGGGAAGTTCAAGGG - Intergenic
992196479 5:74344593-74344615 CTTCAGGAAGGGAAGCTAGAAGG + Intergenic
993880651 5:93356660-93356682 ATGCATGAGGGGAAGTTTGTGGG - Intergenic
997247038 5:132358481-132358503 CTGCAGGAGGGTGAGCTGGAGGG - Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
997834487 5:137181227-137181249 AGGCAGGAGAGGAAGGTGGAGGG + Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998222586 5:140298992-140299014 CTGCAGGAGGCCAAGGTGGGTGG - Intronic
998253442 5:140567670-140567692 CTGCTGGAGGGGGACTGGGAAGG - Exonic
999520727 5:152348320-152348342 CTGCAGGAGGGCAAGTGGCTTGG - Intergenic
999643876 5:153699083-153699105 CTGCAGGGTGGGAAATTAGAGGG + Intronic
1002346800 5:178553809-178553831 CTTCAGGAGGGGAAGAGCGAGGG - Intronic
1002465067 5:179404133-179404155 CTGGAGGAGGAGCAGATGGATGG + Intergenic
1002576523 5:180177145-180177167 CTGGATGAGGGGCAGTGGGATGG + Intronic
1002915718 6:1526288-1526310 CTGCCGGAGGGTAACCTGGAGGG - Intergenic
1004326161 6:14675761-14675783 CTGCAGGAGGGGTTGTTGGCAGG - Intergenic
1005615784 6:27571818-27571840 CTGCGGGAGGGCAAGTCGGGTGG + Intergenic
1005968736 6:30744601-30744623 CTGCGGGAGGAGGAGTTAGAAGG - Intergenic
1006807756 6:36799552-36799574 CTGCAGGCGGGGAGGCTGCAGGG + Intronic
1007482998 6:42162494-42162516 CTGGTGGAGGGCAAGCTGGAGGG + Intronic
1008705561 6:54154382-54154404 CTGCTGGAGGGGAAGTAAGCTGG + Intronic
1012406728 6:98909365-98909387 CTGCAGGAGATGGAATTGGATGG - Intronic
1012563356 6:100615214-100615236 CTGCAGGAGGCCGAGTTGGGTGG - Intronic
1014491355 6:122065575-122065597 ATGGAGGAAGGGAAGTAGGAAGG + Intergenic
1016899910 6:149091221-149091243 CTGCAGGAGGGAAACAGGGAGGG - Intergenic
1017184506 6:151587464-151587486 CTGCAGGAGGGAGTGTGGGAAGG + Intronic
1019405981 7:884323-884345 CTGCAGGACTGGAACTAGGACGG + Intronic
1019891901 7:3954231-3954253 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1019891965 7:3954411-3954433 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1020076416 7:5261742-5261764 CTGCAGGAGGACATGTTGGCTGG + Intergenic
1020162806 7:5785079-5785101 CTTTAGGAGGGCAAGATGGAAGG - Intergenic
1020258185 7:6514338-6514360 CTGCAGGCAGGGAAGTGGCAGGG + Intronic
1020469530 7:8520391-8520413 CTGCAGGAGGAGAAGCCAGACGG + Intronic
1020967240 7:14886715-14886737 CTGCAGGTGGGCCAGATGGAAGG - Intronic
1022331454 7:29383259-29383281 TTGCAGGTGGTGTAGTTGGAAGG + Intronic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1022511328 7:30936717-30936739 CTGCAGGAGAGGAAGTTTGAGGG - Intergenic
1022525651 7:31035329-31035351 CAGCAGCAGGGGAAGAAGGAGGG + Intergenic
1022969927 7:35507576-35507598 CAGCATGAGGGGAAGTTGGAGGG - Intergenic
1023213591 7:37834479-37834501 CTTTAGGAGGGCAAGGTGGAAGG - Intronic
1024184863 7:46939725-46939747 CGGCAGAAGAGGAAGTTGGAGGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024676008 7:51638445-51638467 GGGCAGGAGGAGAAGGTGGAAGG + Intergenic
1024947168 7:54820193-54820215 ATGCAGGTGGGGAAGAGGGAAGG + Intergenic
1025028627 7:55537811-55537833 TTGAAGTAGTGGAAGTTGGAGGG - Intronic
1025240216 7:57265677-57265699 CTGCAGTGGGGGCAGTTGGTGGG + Intergenic
1026911849 7:74095647-74095669 CTTCAGGAGGCGAAGGTGGGAGG - Intronic
1028879684 7:95865978-95866000 ATGCAGGAGGGGTGGTGGGATGG + Intronic
1030578368 7:111319105-111319127 CTGTAGGAGGGCAAGTCTGAGGG + Intronic
1030920057 7:115372583-115372605 CTGCAGTAGGTCAAGGTGGAAGG + Intergenic
1034277403 7:149829838-149829860 CAGGAGGAGGGGATGATGGAGGG - Intergenic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1034998781 7:155594993-155595015 AGGCAGGAGGGGAAGGAGGAAGG + Intergenic
1035176399 7:157055132-157055154 CTGCAGGTGGGGCTGTGGGAGGG - Intergenic
1035310083 7:157961998-157962020 CAGCAGGAGGGAAAGTGAGAGGG - Intronic
1035969723 8:4234358-4234380 CTGCAGGAGTGGAAGATGTGTGG + Intronic
1037751197 8:21683460-21683482 ATGCAGGAGGGGGAGTTTGAGGG + Intergenic
1037768696 8:21786851-21786873 CTGCAGTAGGGGATCTGGGAAGG - Intronic
1037951332 8:23020088-23020110 CAGGAGGAGGGGAGGTTGGGGGG + Intronic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1038731208 8:30129459-30129481 CTTCAGGAGGCCAAGGTGGATGG + Intronic
1039122444 8:34162503-34162525 CTGCATGAGTGGCAGATGGAAGG + Intergenic
1043552910 8:81395129-81395151 CTGCAGGATGTGAAGTTCAAGGG + Intergenic
1044657467 8:94563738-94563760 CTCCAGGAAGGGGAGTTTGATGG + Intergenic
1044959648 8:97517890-97517912 CTGTAGGAGGCCAAGGTGGAAGG + Intergenic
1045743904 8:105394237-105394259 CTGCAAGTGGGGAGTTTGGATGG + Intronic
1046854800 8:119019029-119019051 CTGCAGAAGGGGAAGATAGTAGG - Intronic
1047749078 8:127866489-127866511 CTGAAGGAGAGGGAGTGGGAGGG - Intergenic
1048237617 8:132707282-132707304 CTGAAGGTGAGGATGTTGGAAGG + Intronic
1048327652 8:133451574-133451596 CTGCAGGAGGTGCAGTTCCAAGG + Intergenic
1048385752 8:133911084-133911106 CTTCAGGAGGTGAAGGTGGGAGG + Intergenic
1048535115 8:135286128-135286150 CTTCAGGAGGGTGAGGTGGAAGG + Intergenic
1048773535 8:137920591-137920613 CTCCAGGAGGGGAAGTTGTCAGG + Intergenic
1048812532 8:138302011-138302033 CAGAAGGTGGGGAAGTTGCATGG - Intronic
1049226240 8:141451855-141451877 CTGCAGGAGGGGCAGGTTGGGGG + Intergenic
1049755058 8:144307494-144307516 CTGCAGGAGGCCAAGGTGGGCGG + Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1049986268 9:954574-954596 TTGGAGGAGGAGAAGTTGGTAGG + Intronic
1049998497 9:1052175-1052197 GTGGAGGTGGGGGAGTTGGAGGG + Intronic
1050484879 9:6123513-6123535 CAGCAGGAGCTGAAGTTGAAAGG - Intergenic
1050595970 9:7205075-7205097 CTGCAGGATGTGAATCTGGAAGG - Intergenic
1050846886 9:10232174-10232196 CTGCAGGCTGGGAAGTTCAAGGG - Intronic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1052196842 9:25727681-25727703 CAGCAGGAGAAGAAGCTGGAAGG - Intergenic
1052228118 9:26114389-26114411 CTGAAAGAGGTGAAGATGGAGGG + Exonic
1052465855 9:28829038-28829060 CTGCAGGATGGGGAGTGGGACGG - Intergenic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053552663 9:39100662-39100684 GCAAAGGAGGGGAAGTTGGAAGG + Intronic
1053575557 9:39355561-39355583 CAGCAGGAGGGGGAGGAGGAGGG - Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053816778 9:41920826-41920848 GCAAAGGAGGGGAAGTTGGAAGG + Intronic
1053840063 9:42183500-42183522 CAGCAGGAGGGGGAGGGGGAGGG - Intergenic
1054097118 9:60914248-60914270 CAGCAGGAGGGGGAGAGGGAGGG - Intergenic
1054107038 9:61064508-61064530 GCAAAGGAGGGGAAGTTGGAAGG + Intergenic
1054118524 9:61189877-61189899 CAGCAGGAGGGGGAGAGGGAGGG - Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054456164 9:65431497-65431519 GTGCAGGAGGGGAACTAGGCTGG + Intergenic
1054589233 9:66992687-66992709 CAGCAGGAGGGGGAGAGGGAGGG + Intergenic
1054613819 9:67266617-67266639 GCAAAGGAGGGGAAGTTGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054898634 9:70342807-70342829 CTGGAGGAGAGGAATTTGTAAGG - Intronic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1056673926 9:88656860-88656882 CTTCAGGAGGCCAAGATGGATGG - Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG + Intergenic
1058944329 9:109841964-109841986 GGGATGGAGGGGAAGTTGGAGGG + Intronic
1059226725 9:112679741-112679763 GTGCAGGAGGAGAGGTTAGATGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1060551822 9:124489238-124489260 CTTAAGGAGGGGTAGGTGGAGGG - Intronic
1061047791 9:128176479-128176501 CAGCAGGAGGGAAAGAGGGATGG + Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1062059786 9:134489003-134489025 ATGCAGGAGGGGCAGCTGGTAGG - Intergenic
1062097974 9:134712471-134712493 AGGCAGGAGGGGAAATAGGAAGG - Intronic
1062380354 9:136284040-136284062 CTTCAGGAGAGGAAGCTGGTGGG + Intronic
1062460094 9:136659400-136659422 CTGCAGGAGGTGCAGGAGGAGGG - Exonic
1062540757 9:137040738-137040760 CTGCAGGAGGGGGCGTGTGAGGG + Intronic
1186226795 X:7407540-7407562 CGGCAGGAGAGGAAGAAGGAGGG - Intergenic
1186433080 X:9521161-9521183 TTGCAGGAGGGAAATTTTGAGGG + Intronic
1186562826 X:10630942-10630964 CTGCAGGAGGAGCAGTTGATAGG + Intronic
1186613282 X:11159586-11159608 CTGCAGGAGGAGAAGGTTGGGGG + Intronic
1186720733 X:12300903-12300925 CTGTAGGATGGCAAGGTGGAAGG - Intronic
1188784232 X:34324467-34324489 CCTCAGGAGGGAAGGTTGGAAGG + Intergenic
1189030692 X:37446697-37446719 CTGCAGGCTGGGAAGTTCAAGGG + Intronic
1189084041 X:38001424-38001446 GTGCTGGAGGGGAAGTTGGGAGG - Intronic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191872316 X:65758712-65758734 CAGCAGGTTGGGAAGGTGGATGG + Intergenic
1192149684 X:68704485-68704507 CTGGAGGCTGGGAACTTGGAGGG + Intronic
1192385657 X:70666599-70666621 CTGCAGGCTGGGAAGTTCAAGGG - Intronic
1192634548 X:72805229-72805251 CTGCAGGCTGGGAAGTTGAAGGG + Intronic
1192647165 X:72915572-72915594 CTGCAGGCTGGGAAGTTGAAGGG - Intronic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1195269310 X:103215036-103215058 CTGCAGGAGGGGGCGTGGGACGG + Intergenic
1195278996 X:103311040-103311062 CTGCAGGAGGGGGCGTGGGACGG - Intronic
1195638292 X:107143456-107143478 CTTCAGGAGGCCAAGGTGGATGG - Intronic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1197566729 X:128097188-128097210 CGGCAGGAGGTGAAGAAGGAAGG - Intergenic
1199836415 X:151596207-151596229 CTGCAGGATGAGAAGTTCAAGGG + Intronic
1199929371 X:152503138-152503160 CTGCAGGCAGGGAAGTTCAAGGG + Intergenic
1200062381 X:153489313-153489335 CTGAAGGAGGGGCAGGTGCAGGG - Intronic
1200243709 X:154511608-154511630 CTGCAAAAGGGCAACTTGGAAGG - Intronic
1200255557 X:154580693-154580715 CTGCAGGCGGGGAGGAGGGAAGG - Intergenic
1200262212 X:154623711-154623733 CTGCAGGCGGGGAGGAGGGAAGG + Intergenic
1201489832 Y:14528072-14528094 CTACAGGAGTGGAAGGTTGATGG + Intronic
1201590305 Y:15607415-15607437 CTACAGGTGGGGATGTGGGATGG + Intergenic