ID: 1166318373

View in Genome Browser
Species Human (GRCh38)
Location 19:42001635-42001657
Sequence AAGGCTCAACAAAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166318373_1166318378 -5 Left 1166318373 19:42001635-42001657 CCCTCCACCCTTTGTTGAGCCTT 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1166318378 19:42001653-42001675 GCCTTCAGACCACAGCAGTCTGG 0: 1
1: 0
2: 3
3: 33
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166318373 Original CRISPR AAGGCTCAACAAAGGGTGGA GGG (reversed) Intronic
900439893 1:2649281-2649303 AATGATCACCTAAGGGTGGAGGG - Intronic
901210769 1:7524862-7524884 AAGGCTCAGCCAAGGGGAGAGGG - Intronic
901337436 1:8463271-8463293 GAGGCTCTACAAGGGCTGGATGG + Intronic
902870454 1:19311103-19311125 AAGGCTCAGCAAATGCTGGATGG - Intronic
904973552 1:34437888-34437910 AAGGCCCTAGACAGGGTGGAGGG + Intergenic
906928688 1:50147426-50147448 AAACCTGAACAACGGGTGGATGG - Intronic
907604612 1:55804340-55804362 AAGGCTCAAAAAGGGAAGGAGGG + Intergenic
910351895 1:86307742-86307764 AGGGCTCAACCAGGGGTGGAGGG + Intergenic
910839627 1:91548552-91548574 AAGCCTCTTCAAGGGGTGGAGGG - Intergenic
912541544 1:110420036-110420058 GAGGCTCAAGGAAGGGTGGAGGG + Intergenic
913298652 1:117346792-117346814 AAGGCTCAGCCAAAGGTGAATGG + Intergenic
913609786 1:120499797-120499819 AAGGCTAAACAAAGAGTGAAGGG - Intergenic
913985045 1:143557364-143557386 AGGGCTAAACAAAGAGTGAAGGG + Intergenic
914581405 1:149022444-149022466 AAGGCTAAACAAAGAGTGAAGGG + Intronic
916020641 1:160789286-160789308 AAGGCCCAACTCAGGGTGAAGGG + Intergenic
916071914 1:161175388-161175410 ACAGCTCTACAAAGGCTGGAAGG + Intronic
917649211 1:177060215-177060237 AAGCCTCAAAAAAAGTTGGAAGG - Intronic
917730544 1:177870628-177870650 AGGCCTCAACACAGGGTGGGTGG + Intergenic
921262591 1:213396966-213396988 AAGCCTCTACAAAGAGAGGAAGG - Intergenic
921628669 1:217406909-217406931 AAGGACCAACAAACGGTGAATGG + Intergenic
1063915118 10:10873819-10873841 AAGGCTGGACAAAGGGGTGAAGG - Intergenic
1064652533 10:17523827-17523849 AATCCTCAACAAAGGCTGCATGG + Intergenic
1067098947 10:43320908-43320930 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1070566307 10:77606096-77606118 AGGGCTGCACCAAGGGTGGATGG - Intronic
1072271065 10:93777171-93777193 AAGGCTCATCAAGGGGTGCCTGG - Intronic
1072524310 10:96258062-96258084 AAGGCTTTAGAAAGAGTGGAGGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073013610 10:100381187-100381209 AGGAGTCAACAAAGGGTGGTGGG - Intergenic
1073130242 10:101183850-101183872 GAGACTCAGCAAAGGGTGGTGGG + Intergenic
1073251227 10:102121246-102121268 AAGGCTGGAGAAAGGGGGGAAGG - Intergenic
1073378736 10:103060773-103060795 AAGGTTGAAAACAGGGTGGAAGG + Intronic
1074231814 10:111544941-111544963 AAGCCTCAAAAAAATGTGGAAGG - Intergenic
1076088444 10:127657187-127657209 AAGGAACAATAAAGAGTGGAAGG + Intergenic
1077480934 11:2814252-2814274 AGGGCTGAATAAAGGATGGATGG + Intronic
1084257384 11:67952387-67952409 AAGGCTCAGCAAGTGGTTGAGGG + Intergenic
1084734591 11:71096316-71096338 AAGGCTCAGCAAGGGGTGTGGGG + Intronic
1087557886 11:99745688-99745710 AAGGCTTAACTAAGGTTGGCAGG - Intronic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1088531732 11:110817936-110817958 AAGGCAGAAAAAAGGTTGGAAGG + Intergenic
1092064678 12:5579937-5579959 AAGCCTGAACACAGGGTGGTGGG - Intronic
1092529143 12:9329866-9329888 GAGGCCTAGCAAAGGGTGGAGGG - Intergenic
1093161524 12:15752500-15752522 AAGGCTCAACTTAGGCTAGAGGG - Intronic
1094541059 12:31363618-31363640 AAGGCTCAACACAGGGGGACCGG + Intergenic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1100155881 12:91799788-91799810 AACTCTCAGCAAAGGGTGGGGGG + Intergenic
1101864763 12:108512540-108512562 AAGACTTAACAAAGAGAGGAGGG + Intergenic
1102079321 12:110085265-110085287 AAGGCTCTCCTAATGGTGGAGGG + Intergenic
1103735897 12:123060700-123060722 AAGGCCCAAGGCAGGGTGGAAGG + Intronic
1104233826 12:126912044-126912066 AATACTCATCAAAGAGTGGAAGG - Intergenic
1108006570 13:45953278-45953300 ATGGCTCACCACTGGGTGGAGGG - Intergenic
1108560598 13:51640410-51640432 CATACCCAACAAAGGGTGGAAGG - Intronic
1108702723 13:52957480-52957502 GAGAGTCAACAAAGGGTGGTGGG + Intergenic
1108813046 13:54253578-54253600 GAGGCCCATCAGAGGGTGGAAGG + Intergenic
1111060203 13:83008098-83008120 AAAGTTCATCAAAGGGTGAATGG - Intergenic
1112052557 13:95657329-95657351 AAATCTCAGCAAAAGGTGGAAGG - Intergenic
1115569717 14:34655081-34655103 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1116345883 14:43793194-43793216 AAGTATCAACAAAGGCTTGAGGG - Intergenic
1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG + Intronic
1121842869 14:97149431-97149453 AATGCACAACAAAGGAAGGAAGG + Intergenic
1125637718 15:41203413-41203435 GAGTCTCAACAAAGGGAAGAGGG - Intronic
1128414438 15:67431473-67431495 GAGGCCTATCAAAGGGTGGAGGG + Intronic
1130890633 15:88130956-88130978 GAAGCTGGACAAAGGGTGGAAGG + Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1136532887 16:30881782-30881804 AAGGCTGAAGAAAAGCTGGAAGG - Intronic
1138607940 16:58100476-58100498 AAGGCTCAGTAAAGGCAGGAAGG - Intergenic
1138976803 16:62217519-62217541 AGGGGTCAGCAAAGGGTGGTGGG + Intergenic
1142498273 17:317936-317958 AAGAAACAACAGAGGGTGGAGGG - Intronic
1147539492 17:41345196-41345218 AAGGAGCAGCAAAGGGTAGAGGG - Intergenic
1148976296 17:51532873-51532895 AAGACTCACTAAAGGGTGCAAGG + Intergenic
1150455229 17:65301913-65301935 AAAGCACAACAGAGTGTGGAAGG + Intergenic
1156368661 18:36452912-36452934 AGTGCTCAACAATGGGTGAATGG - Intronic
1156635188 18:39019554-39019576 AAGGATCAAGAAAGGCAGGAAGG - Intergenic
1156900746 18:42297913-42297935 AAGTGTCAACAAAGAGTGCAAGG - Intergenic
1156915564 18:42462108-42462130 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1158231031 18:55255460-55255482 AAGGATGAACAAAGGTTGGTTGG - Intronic
1159365101 18:67455620-67455642 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1165645799 19:37434897-37434919 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1165895445 19:39138605-39138627 AAGGCTAAACCCAGGGTGCACGG - Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1167632281 19:50632524-50632546 GCAGCTCAGCAAAGGGTGGATGG + Exonic
930682481 2:54271728-54271750 TAGCCACAAAAAAGGGTGGAGGG - Intronic
931447337 2:62337653-62337675 AAGGCCCTCCAAAGGGTAGAGGG - Intergenic
931933381 2:67166885-67166907 GAGGCTTATCAGAGGGTGGAGGG + Intergenic
932020205 2:68076985-68077007 AAGGCTGAAGTCAGGGTGGAGGG + Intronic
932144087 2:69304007-69304029 AAGGCTCATCTGAGGGAGGAGGG + Intergenic
933261996 2:80141384-80141406 AAGGTTCAAAGGAGGGTGGAAGG + Intronic
933381374 2:81550812-81550834 AAGCTTCAACAAAAGGTAGAGGG + Intergenic
933545484 2:83706070-83706092 AAGGCCTACCAGAGGGTGGAGGG - Intergenic
933758289 2:85657735-85657757 AAGAGTCAGCAAAGGGTGGTGGG + Intronic
935534054 2:104272400-104272422 AAGGATCAAGAAATGGTGCAAGG - Intergenic
935554061 2:104487844-104487866 AACGCTCATCAATGGGTGAATGG + Intergenic
935921246 2:108017883-108017905 AAGGCTCAACATAGAGTAGGAGG - Intergenic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
943554257 2:189382687-189382709 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1170465146 20:16615982-16616004 AAGGCTCAATAAATGTTGGTTGG + Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1175703107 20:61154749-61154771 AGGGTTCAACACAGGGTGGAAGG + Intergenic
1175977929 20:62722434-62722456 AAGGCTTATCAGAGGGTGGCTGG - Intronic
1177439280 21:21099490-21099512 AGTGCTAAGCAAAGGGTGGAGGG + Intronic
1180801139 22:18632490-18632512 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1180852369 22:19028049-19028071 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1181220581 22:21362771-21362793 AGGGCTCCACAGAGGGTGGAAGG - Intergenic
1182385874 22:29940399-29940421 AAGATTCAGCAAAGGGTGGTAGG - Intronic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183966125 22:41444070-41444092 AGGACTCAACTAAGTGTGGAGGG + Intronic
1184002029 22:41682135-41682157 GAGGCTGGACATAGGGTGGACGG + Intronic
1184238996 22:43201913-43201935 ACGGCTCCACAAAGGGAGGGAGG + Exonic
1185091953 22:48780607-48780629 AAGCCACGACAAAGGGCGGATGG - Intronic
1203281678 22_KI270734v1_random:134976-134998 AGGGCAGCACAAAGGGTGGAGGG + Intergenic
954674249 3:52306980-52307002 AAGGCCCAACTGGGGGTGGAAGG + Intergenic
959456704 3:106571869-106571891 GATGCTCAATAAAGGCTGGAGGG + Intergenic
960266689 3:115628189-115628211 AAGGCTCAACTAAGACTAGAAGG - Intronic
962192890 3:133329758-133329780 AAGGCTAAACACAGGGTGCTGGG - Intronic
962904428 3:139789148-139789170 GAAGCTCAAGAAGGGGTGGAAGG + Intergenic
963043068 3:141083355-141083377 AGGGCTCTACAGAGGGTGGGGGG - Intronic
963274221 3:143314332-143314354 AAGGGTCAGCACAGTGTGGAGGG - Intronic
963667363 3:148205582-148205604 AAGACTCAACAAAGGTTAGGGGG + Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970819889 4:20199150-20199172 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
970920229 4:21385361-21385383 AAGGCTCTACAAAGGGTTCTGGG + Intronic
971035986 4:22693266-22693288 TAGGCACAAGGAAGGGTGGAGGG + Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
972467065 4:39367191-39367213 AAGACCCAACAGGGGGTGGATGG - Intergenic
973155571 4:46947567-46947589 AAGGCGCAAAAAAGGAAGGAAGG + Intronic
975591022 4:75999943-75999965 GAGGCTCAACAAAGGAGGGGAGG + Intergenic
976332280 4:83846370-83846392 AAGGATGAACACAGGGTGGCAGG - Intergenic
976821754 4:89214669-89214691 AAGCCTAAAGAAAGGGAGGAAGG - Intergenic
977592271 4:98840518-98840540 AAAGCCCAACAAAAAGTGGAAGG - Intergenic
982424516 4:155242588-155242610 AAGGCTCAGGGAAGGCTGGAAGG - Intergenic
985071939 4:186174236-186174258 AGGGCCTATCAAAGGGTGGAGGG - Intergenic
986190483 5:5492344-5492366 AATGGTCAACAGAGTGTGGACGG + Intergenic
987007537 5:13725643-13725665 AATACTCAACAAAGGGAGGTTGG - Intronic
987250447 5:16095404-16095426 AAGGATCAAAAAGGGATGGAGGG + Intronic
989219597 5:38942102-38942124 AAGGCTCAACAAAGGAGAGAAGG + Exonic
989519859 5:42388980-42389002 AATGCTCTAAAAAGGGTGAAAGG - Intergenic
990494889 5:56337541-56337563 AAGTATCAAAAAAGGCTGGAAGG + Intergenic
992547622 5:77830028-77830050 AAGTCTGAACATTGGGTGGAAGG - Intronic
994496554 5:100520288-100520310 AAGAGACAACAAAGGGTAGAAGG + Intergenic
996265820 5:121538594-121538616 AACCCTCAACAAAGAGTTGAAGG + Intergenic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
996628056 5:125594228-125594250 AAGACTTAACAAAGAGTTGAGGG + Intergenic
998160009 5:139808111-139808133 AAGGCCCAACAAGGGGAGGAAGG + Intronic
998348851 5:141487628-141487650 CAGGCTCAACAAATGCTTGAGGG + Intronic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
999501777 5:152154090-152154112 TAGGATCAACAAAGGAAGGAGGG + Intergenic
999503759 5:152173830-152173852 AAAGCTAAGCAAAGGGTTGAAGG - Intergenic
999883831 5:155897980-155898002 GATGCTCAACAAAGTCTGGATGG + Intronic
1001974417 5:175985327-175985349 AAGGCTCAGAGAAGAGTGGAGGG + Intronic
1002243017 5:177858452-177858474 AAGGCTCAGAGAAGAGTGGAGGG - Intergenic
1003037189 6:2652511-2652533 TACCCTTAACAAAGGGTGGAAGG + Intergenic
1004362132 6:14980535-14980557 GAAGCTCAAGAAAGGGTGGGGGG - Intergenic
1008219429 6:48837626-48837648 AGGGGTCAGCAAAGGGTGGTGGG - Intergenic
1009404672 6:63297416-63297438 AATGCTCAAAAAAGGGAGTAGGG + Intronic
1010694652 6:78955849-78955871 AAAGCTCTACATAGAGTGGAGGG - Intronic
1012875805 6:104724300-104724322 AAGGCTCAAGAAAGGGGTGTTGG - Intergenic
1013361506 6:109397629-109397651 AAGGCTGAACAAAGGATGTGGGG + Intronic
1013807521 6:114011870-114011892 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1014522641 6:122463940-122463962 AAGGCTCCTCAAATGGTGAATGG + Intronic
1018037446 6:159893425-159893447 AGGGCCCAACAAAGTGAGGAGGG + Intergenic
1018478408 6:164166529-164166551 AAGCCCCAACACCGGGTGGAGGG - Intergenic
1018684162 6:166290295-166290317 TGGGCTCAAAAAGGGGTGGAAGG - Intergenic
1019129485 6:169863144-169863166 GAGGCTCCAGAAAGGGTGGCAGG - Intergenic
1019157462 6:170048864-170048886 CAGGCTCAGCTCAGGGTGGAGGG + Intergenic
1021161984 7:17285132-17285154 TAGGCTCATAAAAGGCTGGATGG - Intergenic
1026541411 7:71282908-71282930 AAGGCTCAAGAAAGGACCGAAGG + Intronic
1029801213 7:102949426-102949448 AGGGCTTACCAGAGGGTGGAGGG - Intronic
1030106401 7:105990895-105990917 AAGGCACAATCAAGGGTGAATGG + Intronic
1030440044 7:109577917-109577939 TAGGCTCATCAAAGAGTGGGAGG + Intergenic
1034472165 7:151261027-151261049 AAGACTCACCAAGGGGTGGGCGG + Intronic
1036597277 8:10225294-10225316 AAGGCACAAAGAAGGGTTGAGGG - Intronic
1037627693 8:20622397-20622419 ATGGCTTAACAAAGGGTTGGTGG - Intergenic
1045336828 8:101212372-101212394 GAAACTCAAGAAAGGGTGGAAGG + Intergenic
1047065995 8:121283894-121283916 AAGCCTCACCAAAGGAAGGAGGG + Intergenic
1047346215 8:124031338-124031360 TAGGTTCAACAAAGCATGGATGG + Intronic
1047897298 8:129381142-129381164 ACGGATCAACAAAGCTTGGATGG + Intergenic
1048175827 8:132151429-132151451 AAGTTTAAACAAATGGTGGAAGG + Intronic
1048909384 8:139120078-139120100 AAGGCTTAACAAGGAATGGAGGG + Intergenic
1050366680 9:4879524-4879546 AAGCCTCTTCAAAGGGTGGGTGG - Intronic
1050664658 9:7921809-7921831 AAGCCTGAAGAAAGAGTGGAAGG - Intergenic
1051374226 9:16387856-16387878 GAGGCTCACCAAGGGGTGCAGGG + Intergenic
1055126487 9:72724276-72724298 AAGGGTCATCCAATGGTGGAAGG + Intronic
1056325720 9:85476712-85476734 AAGGCTCAAAAAAGTGTGTCAGG - Intergenic
1060578751 9:124724025-124724047 AATGCTCAACAATAGGAGGATGG + Intronic
1060688580 9:125635439-125635461 CAGCCTGAACATAGGGTGGAAGG - Intronic
1060691567 9:125665551-125665573 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1185654311 X:1671710-1671732 AAGAGTCAGCAAAGGGTGGCGGG - Intergenic
1187836514 X:23437134-23437156 AAGGCTGAACAAAGGTAGCAGGG - Intergenic
1192502842 X:71664801-71664823 AAGACTCACCAGAGGGTGCATGG + Intergenic
1194694548 X:97029690-97029712 TAGACTCAACAAATGGTGCAGGG - Intronic
1195313808 X:103658577-103658599 AGGGCTAAACAAATGGTGAATGG + Intergenic
1195737910 X:108032762-108032784 AAGGCTGAGCAAAGAGTGGTGGG + Intergenic
1197391709 X:125875362-125875384 TAGGCTAAAAAAAGGGGGGATGG - Intergenic
1197526576 X:127571381-127571403 ATGGCACAATAAAGGGTGAATGG + Intergenic
1197820773 X:130538839-130538861 AAGCCTAAACAAAGTGAGGAGGG + Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic