ID: 1166324013

View in Genome Browser
Species Human (GRCh38)
Location 19:42038134-42038156
Sequence GGTTCTATTGGAGGACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166324013 Original CRISPR GGTTCTATTGGAGGACAAGC TGG Intronic
900253128 1:1682105-1682127 AGTTCTATGGGAGGCCAAGGCGG - Intronic
903050141 1:20594538-20594560 GGTGCTTTTGGAGGCCGAGCTGG + Intronic
904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG + Intronic
906848925 1:49226615-49226637 AGTATTATTGAAGGACAAGCAGG - Intronic
906983366 1:50655943-50655965 GGTTTTATTGAAGGGCAAGGGGG + Intronic
907177472 1:52538413-52538435 AGCACTTTTGGAGGACAAGCTGG + Intronic
912449563 1:109760761-109760783 GGCTCCAATGGAGAACAAGCAGG - Intronic
923329915 1:232913529-232913551 GGTTCTGTTGGAGGACATTTGGG - Intergenic
924552993 1:245095640-245095662 GGTTCTTTGGGAGGCCAAGGTGG - Intronic
1066596726 10:37059177-37059199 AGTTCAATTGGAAGACAATCAGG + Intergenic
1067508494 10:46876320-46876342 GCTTCCCTTGGAGGACAAGTGGG + Intergenic
1067653754 10:48175529-48175551 GCTTCCCTTGGAGGACAAGTGGG - Intronic
1069009922 10:63361173-63361195 GGCACTTTGGGAGGACAAGCTGG + Intronic
1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG + Exonic
1074283378 10:112074442-112074464 GATTCTATTGCAGGACAGGGTGG - Intergenic
1075548327 10:123373126-123373148 GGTTATATTGGAGGAAGAGGGGG - Intergenic
1075613427 10:123872493-123872515 GGTTATCTTTGAGGAGAAGCAGG + Intronic
1078350077 11:10585901-10585923 GCTTCTATTGAAAGAAAAGCGGG - Intronic
1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG + Intronic
1083931101 11:65846022-65846044 AGTTCTATGGGAGGCCAAGGTGG + Intronic
1084796054 11:71504770-71504792 GGTTCTATTGGAACACAGCCAGG - Intronic
1089002318 11:115062054-115062076 GATTCTCTTTGAGGTCAAGCTGG - Intergenic
1090401670 11:126453219-126453241 TGGTCTATTTGAGGACAACCTGG - Intronic
1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG + Intergenic
1091204401 11:133809870-133809892 GGTACTATGGGATGACAGGCGGG - Intergenic
1098217687 12:68237351-68237373 TGATCTTTTGGAGGACAAGAAGG - Intergenic
1100103868 12:91144383-91144405 GTTTCTATTGGAAGACATTCAGG - Exonic
1100506621 12:95227202-95227224 TGTTCTATTGGAGGCCAGCCTGG - Intronic
1100576759 12:95899091-95899113 CTTCCTATTGGAGGAGAAGCTGG - Intronic
1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG + Intronic
1110443040 13:75546525-75546547 GCTTCTATTCAAAGACAAGCAGG - Intronic
1113106306 13:106775217-106775239 AGTGCTGTTGGGGGACAAGCGGG - Intergenic
1114374888 14:22133660-22133682 TGTTCTGTAGGAGGACAAGCAGG - Intergenic
1117301404 14:54432202-54432224 GGTACTCTGGGAGTACAAGCTGG + Exonic
1120543614 14:85782174-85782196 GATTCTATTGGAGATGAAGCTGG - Intergenic
1129860637 15:78858339-78858361 GGTTCTTTTGGAGGCCGAGGCGG + Intronic
1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG + Exonic
1138244630 16:55458314-55458336 GGTTGTATTGGAGGACGAGATGG + Intronic
1150091269 17:62327483-62327505 TGTTCTATTGTAGAACAAGATGG + Intergenic
1152132511 17:78485625-78485647 GGTGCTGATGGGGGACAAGCTGG - Exonic
1157525660 18:48378519-48378541 GGTTTTATTGGAGAACCATCTGG - Intronic
1157869525 18:51217488-51217510 GGTTCTAATGGAAGAGAAGGTGG - Intronic
1162043592 19:7984826-7984848 GTTTCTATTGGAGGCAAAGGTGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
927045677 2:19275862-19275884 GGTTCTATTGTAGGACCTTCTGG + Intergenic
935411891 2:102772607-102772629 GGTTCTATGGGGGTACAAGCTGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946758767 2:222972669-222972691 GATTCTAATGGGGGAAAAGCCGG + Intergenic
1169088488 20:2841625-2841647 GATTCTATTGGGGGAGAATCAGG - Intronic
1171427943 20:25060118-25060140 GGTTCCATGGGAGGATAAGCTGG - Intergenic
1172030995 20:31981997-31982019 AGTGCTATTGGAGGACAGCCAGG - Intronic
1174616008 20:51836002-51836024 TGTTATATTGGAGGAAAAGCAGG - Intergenic
1178977381 21:37231569-37231591 GGATCAAGTGAAGGACAAGCTGG - Intronic
1179929846 21:44559955-44559977 GGCTCTGTTGGAGGACTACCTGG + Intronic
1182094694 22:27618146-27618168 GGTTATATTGGAGGAAGGGCTGG + Intergenic
1182966934 22:34530890-34530912 GTTAATATTGGAGGACAGGCAGG - Intergenic
1184152130 22:42645416-42645438 TGTGCTCTTGGAGGACAAGCGGG - Intronic
1185061531 22:48609591-48609613 GGTTCTTTTGCAGGAGAAACGGG - Intronic
950288611 3:11765131-11765153 AGTTCTTTTGGAGGAAAAACAGG - Intergenic
951306779 3:21073618-21073640 GATTCTTTTGGAAGACAAACAGG + Intergenic
954530122 3:51311173-51311195 GCTGCTCTTGCAGGACAAGCTGG - Intronic
956021022 3:64933426-64933448 GGGTCTCTAGGAGGACAGGCTGG + Intergenic
958004708 3:87796072-87796094 GTTTCTGTTGGAAGACAAGAAGG + Intergenic
958029077 3:88085347-88085369 GGTTTTATTGGAACACAACCAGG - Intronic
959438552 3:106348176-106348198 GGTTCTATTGGCTGAAAAGAAGG - Intergenic
965704722 3:171494774-171494796 GGTTGGAGTGGAGGAGAAGCAGG + Intergenic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
967660696 3:192105844-192105866 GAATCTATTGGAGGACATGAAGG - Intergenic
969562934 4:7960918-7960940 GGTTGTTTTGGAGGAAAGGCTGG - Intergenic
971144674 4:23963765-23963787 GGATCTACTGCAGGACAACCAGG - Intergenic
971368985 4:26000474-26000496 GGTTCTGTGCCAGGACAAGCAGG - Intergenic
971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG + Intronic
972567961 4:40285822-40285844 GGTGCTGACGGAGGACAAGCCGG + Intergenic
985212187 4:187607086-187607108 GGTTCTTATGGAGGAGAGGCTGG + Intergenic
991294741 5:65068771-65068793 GATTCAAATGGAGGACAAGAGGG - Intergenic
1003090830 6:3101340-3101362 AGCTCTTTGGGAGGACAAGCTGG + Intronic
1003380480 6:5620460-5620482 TGTTCAAATGTAGGACAAGCTGG + Intronic
1004154838 6:13158382-13158404 GGCTATATGGGAGGACAAGGGGG - Intronic
1004393360 6:15227597-15227619 GGTGCTTTGGGGGGACAAGCGGG + Intergenic
1004589124 6:17031717-17031739 GCTTCTACTTGAGGACAAGCAGG + Intergenic
1006087615 6:31607750-31607772 GGGTATATAGGAAGACAAGCGGG - Intergenic
1008154034 6:47991047-47991069 TGTTTGATTGGAGGACAAGAGGG + Intronic
1011149746 6:84257867-84257889 GGTTCTGTTGGAGCAGAGGCAGG + Intergenic
1012139123 6:95599530-95599552 TATTCTAATGGAGGACAATCTGG + Intronic
1013435554 6:110101938-110101960 GGTGCAATTGGAGGAGGAGCTGG + Exonic
1015498927 6:133910031-133910053 GGTGTCACTGGAGGACAAGCAGG + Intergenic
1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG + Intronic
1017770225 6:157638876-157638898 GGTTCTAGTGGGGGACATGGAGG + Intronic
1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG + Exonic
1021090268 7:16474625-16474647 GGTTATATTAGAACACAAGCAGG + Intronic
1022581445 7:31559207-31559229 GATTCTATTGGAGTAGTAGCAGG - Intronic
1025603822 7:63024522-63024544 GGTTATAGTGGAGGAAAAGCTGG - Intergenic
1029921152 7:104265737-104265759 GGTTCTAGTGGAGAATACGCAGG - Intergenic
1033622668 7:143076358-143076380 GCTTCTTTTGGAGGATGAGCTGG + Intergenic
1036781374 8:11650198-11650220 GGTTACAGTGGAGGAAAAGCTGG + Intergenic
1041086971 8:54265728-54265750 GGTTATTTTGGAGGGCAAGGAGG + Intergenic
1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG + Exonic
1046027355 8:108740903-108740925 GTTTGTATTGGAAGAAAAGCTGG + Intronic
1047241525 8:123093993-123094015 GGTTCTGATGGAGGAAAGGCTGG - Intronic
1048413394 8:134199277-134199299 GGTTCCATTAGAGGCCAAGTTGG + Intergenic
1051680456 9:19602398-19602420 GTTTATATTGGAGAAGAAGCAGG + Intronic
1052600948 9:30629852-30629874 GGTTCTATTTTAGGACCAACAGG - Intergenic
1056444440 9:86652215-86652237 GGTTTTAATGCAGGACAAGTGGG + Intergenic
1058334998 9:103815850-103815872 GACTCTATTGGAGAACAACCAGG - Intergenic
1059600807 9:115776329-115776351 GGTTTTCTTGGGAGACAAGCAGG + Intergenic
1061847048 9:133393718-133393740 GGTTCTATTGGAGGTGTAGATGG + Intronic
1187216641 X:17283283-17283305 GGTTCCAGTGGAGGGGAAGCGGG + Intergenic
1189798206 X:44666416-44666438 GGTACTTTGGGAGGCCAAGCTGG + Intergenic
1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG + Intergenic