ID: 1166324570

View in Genome Browser
Species Human (GRCh38)
Location 19:42041432-42041454
Sequence ACACATCGCTTGGCAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166324570_1166324578 25 Left 1166324570 19:42041432-42041454 CCAGTATCTGCCAAGCGATGTGT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1166324578 19:42041480-42041502 ACCCTCACTATAGACCTGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166324570 Original CRISPR ACACATCGCTTGGCAGATAC TGG (reversed) Intronic
902646026 1:17798457-17798479 ACAGCTCGCCTGGCAGATGCTGG + Intronic
903393822 1:22984065-22984087 ACAGATCGTTTGGCTGATTCTGG - Intergenic
904833206 1:33318809-33318831 TAGCATCGCTTGGCAGGTACTGG - Intronic
905210393 1:36370008-36370030 AGCCATGACTTGGCAGATACTGG - Intronic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
912933577 1:113984438-113984460 ACCCATCACTTGGCAGAAATAGG + Intergenic
915539970 1:156559411-156559433 ACAAAATGCTTAGCAGATACGGG + Intronic
919704795 1:200666430-200666452 ACACAGCGCTGGGCAGAACCAGG - Exonic
1078859014 11:15230361-15230383 ACACATCGCATGGCAGAAGCAGG + Intronic
1081091329 11:38869434-38869456 ACACAGCCCTTGGCACATAGCGG + Intergenic
1082149253 11:48713081-48713103 AAATATCCCTTTGCAGATACTGG + Intergenic
1082149537 11:48718348-48718370 AAATATCTCTTTGCAGATACTGG - Intergenic
1082621856 11:55432786-55432808 ACTTATCGCTTTGCAGAGACTGG + Intergenic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085496547 11:76975276-76975298 ACACATTACTTGGCACATAGTGG + Intronic
1088987769 11:114925277-114925299 AGACATTTCTTGGCAGATAAGGG - Intergenic
1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG + Intergenic
1097515164 12:60595038-60595060 ACAAATTACTAGGCAGATACAGG - Intergenic
1097585478 12:61510658-61510680 ACACAGTGCTTGGCACATATGGG + Intergenic
1098231585 12:68376518-68376540 ACACATTGCCTGGCAGAAGCAGG + Intergenic
1099777258 12:87149945-87149967 ACACAGTTCTTGGCTGATACTGG + Intergenic
1101630631 12:106490542-106490564 TCACATCACTTGCCATATACCGG - Intronic
1105882226 13:24615008-24615030 GCACAGCGCTTTGCAGACACAGG + Intergenic
1106383558 13:29263639-29263661 GCACATCACATGGCAGAAACAGG + Intronic
1107203490 13:37751823-37751845 TCACTTTGCTTGGGAGATACAGG - Intronic
1109267818 13:60221208-60221230 ACAAATGCCTAGGCAGATACAGG + Intergenic
1110534987 13:76640575-76640597 CCACAGCTCTTGTCAGATACTGG + Intergenic
1111518555 13:89367244-89367266 ACACATCACTTGGCAAAGGCAGG - Intergenic
1113993844 14:16051305-16051327 ACACTTGCCTTGGCAGATTCTGG + Intergenic
1114213980 14:20641556-20641578 ACACATTGCCTGTCAGATTCAGG + Exonic
1118059504 14:62119651-62119673 ACACATCTCATGGCAGATGACGG - Intergenic
1118470801 14:66073758-66073780 ACACATCTCTTCTCAGATAGTGG + Intergenic
1118661602 14:68019691-68019713 AGTCATCCCTTGGCATATACTGG - Intronic
1120942174 14:89958794-89958816 ACAAATCCCTAGGCAGATAGGGG - Intronic
1123826471 15:24087023-24087045 ACACATCCTTAGGCAGATATGGG - Intergenic
1124590590 15:31049959-31049981 ACACATCGCATGGCAGTTCTTGG - Intronic
1125918677 15:43511358-43511380 ACACATGGCATGGAAGATGCAGG - Intronic
1134237774 16:12481087-12481109 GCACATTGCTTGGCTGACACAGG - Intronic
1134365080 16:13569687-13569709 ACACATCTTTTGGCATATTCTGG - Intergenic
1136920876 16:34272276-34272298 ACACATCACTACGCAGTTACTGG - Intergenic
1137182037 16:37725749-37725771 ACACATCACTACGCAGATTCTGG - Intergenic
1137196711 16:37968596-37968618 ACACATCACTACGCAGATTCTGG - Intergenic
1137209092 16:38172745-38172767 ACACATCACTACGCAGATTCTGG - Intergenic
1137211156 16:38207070-38207092 ACACATCACTACGCAGATTCTGG - Intergenic
1140196295 16:72858361-72858383 ACACATTACTTGGCAGAAACTGG + Intronic
1144423131 17:15115981-15116003 ACAAATGGCTAGGCAGATAGGGG + Intergenic
1145916060 17:28574690-28574712 ACACACCTGCTGGCAGATACTGG + Exonic
1147534232 17:41308315-41308337 GCAGATGGGTTGGCAGATACTGG + Exonic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1152978693 18:251320-251342 ACATCTCCCTGGGCAGATACAGG + Intronic
1158476987 18:57788970-57788992 ACAAAATGCTTGGCAGATCCAGG + Intronic
1159308675 18:66679198-66679220 ACAAATGCCTTGGCAGATAGCGG - Intergenic
1162949101 19:14060102-14060124 AGACATCGCTTTCTAGATACTGG - Intergenic
1165872045 19:38979983-38980005 TCAAATCCCTTGGCAGATAGGGG + Intergenic
1166324570 19:42041432-42041454 ACACATCGCTTGGCAGATACTGG - Intronic
931095131 2:58931158-58931180 ACACATTACTTGGCATATAGTGG - Intergenic
933463416 2:82619373-82619395 ACTCATGGCTTGGCTGACACTGG + Intergenic
947454519 2:230241627-230241649 TCACATCTGTTGGCAGATAAGGG - Intronic
1173935386 20:46857625-46857647 ACAGATCGGTTGGCAGACTCTGG + Intergenic
1175883925 20:62277498-62277520 ACACAGCACATGGCAGACACTGG - Intronic
1177578770 21:22993162-22993184 ACACATCTGTTGGCAGATGCTGG + Intergenic
1178130141 21:29563144-29563166 ACAAATCCCTTGGCAGGCACAGG + Intronic
1178151747 21:29802754-29802776 ACACATTTCTTGGCAGACAGAGG - Intronic
1180313424 22:11256208-11256230 ACACTTGCCTTGGCAGATTCTGG - Intergenic
1181094838 22:20497816-20497838 ACACATCACTGGGCTTATACTGG - Intronic
950763624 3:15256943-15256965 ACACAGGGCTGGGCAGATCCAGG + Exonic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
965250222 3:166333093-166333115 ACAAATCCCTAGGCAGATATGGG - Intergenic
966613992 3:181894947-181894969 AGACATAGCTTGGCACATACAGG - Intergenic
968162836 3:196441021-196441043 TCACATCCCTTGGCAGAGACTGG - Intergenic
970291323 4:14575639-14575661 ACCCAGAGCTTGGCATATACTGG - Intergenic
973771321 4:54209700-54209722 AGACAGTGCTTGGCATATACTGG - Intronic
977501667 4:97847738-97847760 ACACATCGTTTGGTAGTTGCAGG - Intronic
977918603 4:102620119-102620141 ACACATCTCTTGGTTGATGCTGG - Intergenic
982419443 4:155177308-155177330 ACAAATAGCTAGGCAGAAACAGG + Intergenic
988538010 5:32086264-32086286 ACACACCACTGGCCAGATACTGG + Intronic
991082067 5:62612202-62612224 ACAGATCGTTTGGAAAATACTGG - Intronic
994586782 5:101718932-101718954 AAACATAGGTTGCCAGATACCGG - Intergenic
1003082544 6:3033283-3033305 AGACATCGCTTGTGAGTTACTGG + Intergenic
1004028565 6:11843362-11843384 ACAGATGGCTTGGAAGATGCTGG - Intergenic
1008760910 6:54850012-54850034 ACATATTGCTTGGCAGATAATGG - Intronic
1018610280 6:165641848-165641870 AAACACCGCTTGCCAGAGACGGG - Intronic
1021147061 7:17101872-17101894 CCACATGGCTAGGCAGATAGGGG - Intergenic
1023544098 7:41298879-41298901 ACAAATCCCATGGCAGATCCTGG + Intergenic
1023705242 7:42933721-42933743 GCACATTGCTTGGCATATAGTGG - Intronic
1035317954 7:158008706-158008728 ACACAGCGCTTGGCGCATGCGGG + Intronic
1039434112 8:37547861-37547883 ACACATGGCTGGGCAGTTGCTGG + Intergenic
1041152030 8:54944766-54944788 ACAAATCCCTAGGCAGATAGGGG - Intergenic
1045817590 8:106294574-106294596 GCACATCACATGGCAGATGCAGG + Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1053728025 9:41024073-41024095 ACTAATCGCTTTGCAGATAAAGG + Intergenic
1054854037 9:69878917-69878939 GCACATCGCATGGCAGAAGCAGG + Intronic
1055962850 9:81836779-81836801 ACACATCACATGGCAGAAACGGG + Intergenic
1058295748 9:103304161-103304183 ACAAATGGCTGGGCAGATAAGGG - Intergenic
1058703419 9:107619741-107619763 ACACAGCGCTGGGCAGACAGAGG + Intergenic
1059912101 9:119055892-119055914 ATACATCACTTAGTAGATACAGG + Intergenic
1061044107 9:128155121-128155143 ACAAATATCTTGGCAGATAGGGG + Intergenic
1203361932 Un_KI270442v1:223649-223671 ACACAGGCCTTGGCAGATTCTGG - Intergenic
1188553556 X:31386632-31386654 ACACAGTGCTTGGCACATAATGG + Intronic
1192077471 X:68014946-68014968 ACACATTGCTTGGCAGGGGCAGG + Intergenic
1195911048 X:109888951-109888973 ACACATCAGTTGTCAGACACTGG + Intergenic
1195918724 X:109961313-109961335 ACACATCATTTTGCAGATATAGG + Intergenic
1196634762 X:117989810-117989832 TCACATCCCTTAGAAGATACAGG + Intronic
1197428083 X:126323296-126323318 ACACCTGGCTTGCCAGATAATGG + Intergenic
1201774683 Y:17649724-17649746 ACACAGGCCTTGGCAGATCCTGG + Intergenic
1201826873 Y:18256265-18256287 ACACAGGCCTTGGCAGATCCTGG - Intergenic